Open Access

Real-time reverse transcription PCR-based sequencing-independent pathotyping of Eurasian avian influenza A viruses of subtype H7

Virology Journal201714:137

https://doi.org/10.1186/s12985-017-0808-3

Received: 16 May 2017

Accepted: 14 July 2017

Published: 24 July 2017

Abstract

Low pathogenic avian influenza viruses (LPAIV) of the subtypes H5 and H7 are known to give rise to highly pathogenic (HP) phenotypes by spontaneous insertional mutations which convert a monobasic trypsin-sensitive endoproteolytical cleavage site (CS) within the hemagglutinin (HA) protein into a polybasic subtilisin-sensitive one. Sporadic outbreaks of notifiable LPAIV H7 infections are continuously recorded in Europe and in Asia, and some lineages showed zoonotic transmission. De novo generation of HPAIV H7 from LPAIV precursors has been reported several times over the past decade. Rapid differentiation between LP and HP H7 virus strains is required as a prerequisite to emplace appropriate control measures. Here, reverse transcription real-time PCR assays (RT-qPCR) were developed and evaluated that allow LP and HP pathotype identification and distinction by probe-assisted detection of the HACS. These new RT-qPCRs allow a sensitive and highly specific pathotype identification of Eurasian subtype H7 AIV in allantoic fluids as well as in diagnostic field samples. RT-qPCR assisted pathotyping presents a rapid and sensitive alternative to pathotyping by animal inoculation or nucleotide sequencing.

Keywords

Avian influenza Hemagglutinin subtype H7 Pathotyping Real-time RT-PCR Diagnosis Cleavage site

Background

Avian influenza viruses (AIV) are members of the family Orthomyxoviridae, specified as influenza virus type-A. These viruses are further classified by the serologically defined subtypes of the predominant viral surface glycoproteins, the hemagglutinin (HA) and neuraminidase (NA) [1]. Their genome is composed of single-stranded, negative-sense RNA and comprises eight genome segments which encode at least ten proteins [2]. All 16 HA and nine NA AIV subtypes can be detected in populations of aquatic wild birds which form the natural reservoir of these viruses [3].

Based on their pathogenicity in chickens, two phenotypes of AIV are distinguished: highly pathogenic (HP) AIV and AIV of low pathogenicity (LPAIV). In nature, HP phenotypes have been restricted to viruses of subtypes H5 and H7. HPAIV arises from LPAI precursor viruses by spontaneous mutations leading to the insertion of basic amino acids into the cleavage site (CS) of the hemagglutinin protein (HA) which renders the HACS processible to subtilisin-like host proteases that are ubiquitous in all host tissues. Such viruses, therefore, gain competence for fatal systemic infections in avian hosts. LPAIV, in contrast, depends on local provision of trypsin-like proteases at the epithelial surfaces of the respiratory and/or gastrointestinal tracts and per se do not cause severe clinical signs [4]. All LPAIV and HPAIV infections of subtypes H5 and H7 in poultry are notifiable to the World Organization for Animal Health (O.I.E.). [5] Determination of the type of HACS is of utmost importance for the diagnosis of these infections. This can be achieved biologically by determination of the intravenous pathogenicity index (IVPI) in experimentally inoculated chickens or molecularly by nucleotide sequence analysis of the site encoding the HACS [6]. Since animal experiment facilities or expensive equipment are required for either pathway, solutions for alternative techniques have been sought in the past: These included restriction enzyme cleavage patterns [7], probe hybridization [8] and real time RT-PCR (RT-qPCR) approaches [9]. Based on the widespread availability of RT-qPCR technology in diagnostic laboratories and its recent favorable use in pathotyping of HPAIV H5 of the goose/Guangdong (gs/GD) lineage [10], this study was conducted to develop and validate sequencing-independent RT-qPCRs for pathotyping of Eurasian H7 AI viruses.

Over the past two decades, several incursions into poultry of subtype H7 LPAIV as well as the de novo generation and (in one case) spread of H7 HPAI viruses have been reported from Europe (Table 1). Other H7 LPAIV lineages have arisen in Eastern Asia, and one of them (H7N9/China) showed significant zoonotic propensities in annual waves of poultry-to-human transmission with more than 550 fatal human cases [11, 12]. Recently, the H7N9 lineages has also yielded an HP mutant which is spreading in southern China [13]. Considering the annual presence of LPAIV of subtype H7 in Eurasian wild bird populations [14] risks of new incursions into poultry in Europe are perpetuating.
Table 1

Outbreaks in poultry of subtype H7 avian influenza viruses of low (LP) and high (HP) pathogenicity in Europe, 1999–2016 [20]

Year

Country

Subtype

Pathotype

Number of infected holdings

1999–2000

Italy

H7N1

HP

1

2003

Netherland

H7N7

HP

255

2008

United Kingdom

H7N7

HP

1

2009

Germany

H7N7

LP

1

2009/2010

Spain

H7N7

LP/ HP

1/1a

2011

Germany

H7N7

LP

23

2013

Denmark

H7N7

LP

1

2013

Italy

H7N7

HP

6

2015

United Kingdom

H7N7

LP/ HP

1/1

2015

Germany

H7N7

LP/ HP

1/1

2015

Netherland

H7N7

LP

2

2016

Denmark

H7N7

LP

1

2016

Italy

H7N7

HP

2

a Slash indicates that a matching pair of LP precursor and HP mutant viruses had been detected

Methods

Based on the alignments of the HA H7 gene of a comprehensive selection of sequences from LP (n = 60) and HPAIV (n = 21) of Eurasian origin collected over the last decade in sequence databases (GenBank at NCBI; EpiFlu of the Global Initiative on Sharing Avian Influenza Data (GISAID)), a set of six primers was designed (Table 2). The selected primers targeted a short fragment of the HA gene that spans the endoproteolytic CS region [1517]. The primers were designed for the broadest possible reactivity with recent Eurasian H7 sequences.
Table 2

Primers and probes used for sequencing-independent pathotyping of Eurasian avian influenza A subtype H7 viruses by real time RT-PCR

Primer/Probe ID

Sequence (5′ to 3′)

Location

Amplicon size

Accession numbera

H7_CS-F1

TGMTGCTRGCAACAGGAAT

989–1007

107b

KX979524

H7_CS-F2 N

TGCTACTRGCAACAGGGAT

989–1007

H7_CS-F3

TGMTGCTGGCAACWGGRAT

968–986

H7_CS-R1N

CGTCAATKAGRCCTTCCCA

1096–1078

H7_CS-R2N

TCCATTTTCWATRAAACCYGC

1056–1036

H7_CS-R3

CATCAAYCAGACCYTCCCA

1056–1076

H7_CS-LP-FAM

C + C + AAAG + GGA + A + GAG + GC

1026–1040

KY676327.1

H7_CS-HP_EMS-FAM

CCAAAGAGAAAGAGAAGAGGCC

1027–1046

120c

AB438941

H7_CS-HP_IT-FAM

TTCCAAAAGGATCGCGTGTGAGGA

1004–1027

KF493066

aAccession number of sequence/virus used to position the oligonucleotide along the HA gene

bsize applied to LP sequences

csize applied to HP sequences

+ indicates that the following position constituted a “locked” nucleotide (LNA)

For validation of the assays, viral RNA from reference H7 LPAIV and HPAIV was used. Moreover, non-H7 influenza subtypes H5 and H9 as well as other avian respiratory viruses (infectious bronchitis virus (IBV), Newcastle disease virus (NDV)) were tested (Table 3). Viral RNA was purified with the QIAamp®Viral RNA Mini Kit (Qiagen, Hilden Germany) according to the manufacturer’s instructions. Primers were first evaluated in conventional RT-PCRs. The PCR reactions were carried out on a CFX96 thermocycler machine (Bio-Rad) using the following temperature profile: 30 min at 50 °C (RT), 2 min at 94 °C (inactivation of reverse transcriptase/activation of Taq polymerase), followed by 42 cycles of 30 s at 94 °C (denaturation), 30 s at 56 °C (annealing), and 30 s at 68 °C (elongation). Twenty-five μL per reaction were prepared using the SuperScript III One-Step RT-PCR system with Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA): For one reaction, 6.5 μl of RNase-free water, 12.5 μl reaction mix (2×), 1 μl of SuperScript III RT/Platinum Taq, and 5 μl of template RNA were mixed. Pre selected primers were then screened for their specifity using non H7-subtypes. Amplificates of the expected sizes were generated from both LP and HP phenotypes of subtype H7 viruses by conventional RT-PCR and visualized on an 2% agarose gel (Fig. 1).
Table 3

Analytical performance characteristics of real time RT-PCR (RT-qPCR) assays for sequencing-independent pathotyping of Eurasian reference H7 viruses

Reference virus

Accession number of HA

Sub- and pathotype

RT-qPCR method

LPAI H7

HPAI H7 ‘Emsland’

HPAI H7 ‘Italy’

A/mute swan/Germany/R901/2006

EPI359695

LP H7N7

Pos

Neg

Neg

A/Anhui/1/2013

AHZ60096

LP H7N9

Pos

Neg

Neg

A/chicken/Germany/AR1385/2015

SA

HP H7N7

Neg

Pos

Neg

A/broiler/Italy/445/1999

AJ580353

HP H7N1

Neg

Neg

Pos

A/turkey/Germany/R2025/2008

SA

LP H5N3

Neg

Neg

Neg

A/turkey/Germany/AR2485–86/2014

EPI552746

HP H5N8

Neg

Neg

Neg

A/chicken/Egypt/AR753–14/2013

EPI557457

HP H9N2

Neg

Neg

Neg

A/chicken/Sudan/AR251–15/2014

KX272465

IBV

Neg

Neg

Neg

A/chicken/Egypt/AR254–15/2014

SA

NDV

Neg

Neg

Neg

LP low pathogenic, HP high pathogenic, Neg negative, Pos positive, SA sequence available from the authors, also represented in the alignment in Additional file 1: Figure S1, IBV Infectious bronchitis virus, NDV Newcastle disease virus

Fig. 1

PCR-products generated to distinguish between low and high pathogenic avian influenza viruses of subtype H7. Primers listed in Table 2 were used for amplification. M - DNA size marker (50 bp ladder); 1 - LP H7N7 (A/mute swan/Germany/R901/2006); 2 - LP H7N9 (A/Anhui/1/2013); 3 – HP H7N1 (A/broiler/Italy/445/1999); 4 - HP H7N1 (A/chicken/Germany/AR1385/2015); 5 - LP H5N2 (A/teal-Foehr/Wv1378–79/2003) used as negative control

Having assured the broad but exclusive specificity of the selected primers for Eurasian H7 viruses, matching probes for use in the RT-qPCR assays were developed. Initially, probes were designed with the aim to universally differentiate between LP and HP Eurasian H7 CS sequences. Probes were therefore placed directly across the sequence stretch encoding the CS. Closer inspection of the alignments, and taking into account also the list of HP H7 CS sequences provided by OFFLU [6], revealed that HP H7 CS sequences of Eurasian origin viruses were highly divergent: Viruses of separate outbreaks and epizootics represented unique CS sequences with little homology to viruses of other outbreaks. Within an outbreak series, however, HP H7 CS sequences proved to be conserved. This situation is opposed to HPAI H5 viruses of the gs/GD lineage which show considerable conservation even across different clades and allowed designing of a universal conserved probe for the HP phenotype of these viruses [10]. In contrast to HP H7, the HA CS of LP H7 viruses of Eurasian origin origin appeared to be fairly conserved [6]. Therefore, two strategies were followed to prove that sequencing-independent pathotyping by RT-qPCRs is principally possible also for Eurasian H7 viruses:
  1. 1.

    For HP H7, probes were designed that are specific for viruses of distinct outbreaks. Two distinct HP H7 outbreaks were selected: Isolates from a historic epizootic (Italy 1999, H7N1) and from the most recent HP H7 outbreak in Germany (referred to as ‘Emsland’; a region in the Northwest of Germany where a very high density of poultry population is reared) affecting a single holding in 2015 (H7N7) were chosen and specific Taqman probes matching the HA CS consensus sequences of each of these outbreaks designed (Table 2).

     
  2. 2.

    For Eurasian LP H7 a universal probe was developed and several universal Taqman probes were synthesized for comparison.

     

The same PCR conditions as described above for conventional RT-PCR were used for RT-qPCR, however, 2 μL of the RNAse-free water were replaced by 2 μl specific primer-probe mix. The HP mixes were composed of 1,25 pmol probe/μl and 3,75 pmol/μl for each forward and reverse primer.

Results

Specificity was initially confirmed only for the two HP probes which specifically reacted with their homologous sequences but did not cross react with LP H7 or other HP H7 viruses (Table 3). The standard Taqman LP probes, however, did not sharply distinguish between pathotypes and cross reacted with various HP H7 viruses (not shown). Closer inspection of the alignments revealed that a single G/A mutation in the HA CS distinguished between LP and HP pathotypes (Fig. 2). Consequently, an LNA probe was designed placing the critical nucleotide position at the centre of the respective probe. Using this probe at a concentration of 2,5 pmol in the reaction mix finally allowed clear-cut distinction between LP and HP pathotypes by RT-qPCR (Table 3).
Fig. 2

Alignment of probes within the hemagglutinin gene segment site encoding the cleavage site of low pathogenic (LP, upper panel) and highly pathogenic (HP, lower two panels) Eurasian avian influenza viruses of subtype H7. Upper panel shows perfect binding of an LNA probe (LNA positions in blue color) and of a conventional Taqman probe specific for LP H7 viruses. Central panel shows the same conventional Taqman probe binding to (and cross reacting with) a Eurasian HP H7 sequence. Lower panel shows hybridization of the LNA probe to an HP H7 ‘Emsland’ sequence; two hybridization positions are possible: The locked ‘G’ mismatch placed in the centre of the probe (red box) disabled binding and cross reaction at each of the two hybridization sites

The detection limit of the H7 pathotyping RT-qPCRs was determined by testing ten-fold serial dilutions of viral RNAs extracted from representative H7 LPAI and HPAI viruses. Average values of three independent runs were used for comparisons to a generic RT-qPCR for the M gene of these viruses [18]. A standard curve of each assay was generated showing a linear relationship between the log dilution of the viral RNA and the cycle quantification (Cq) value for both the specific and the generic assays (Fig. 3a-c). Considering the universal LP as well as the ‘Emsland’-specific HP probe, no significant difference between the median Cq values of each specific assay and the M RT-qPCR was found indicating that the newly developed and the generic RT-qPCRs have a similar analytical sensitivity. In contrast, the RT-qPCR detecting the historic Italian H7 HP lineage showed slightly higher sensitivity than the generic M RT-qPCR.
Fig. 3

Determination of the limit of detection of three newly developed RT-qPCRs for sequencing-independent pathotyping of Eurasian avian influenza H7 viruses (blue dots/lines) compared to a matrix gene-specific generic RT-qPCR (Hoffmann et al., 2010; black diamonds/lines). The detection limit was determined based on serial ten-fold dilutions using RNA of the reference viruses (a) A/chicken/Germany/AR1385/2015 (HPAIV H7N7), (b) A/mute swan/Germany/R901/2006 (LPAIV H7N7) and (c) A/broiler/Italy/445/1999 (HPAIV H7N1). d Detection of artificial mixtures of H7 LP and HPAIV RNA of the ‘Emsland’ outbreak compared to a matrix gene-specific generic RT-qPCR (black diamonds). RNA of the reference viruses A/chicken/Germany/AR915/2015 (LPAIV H7N7) and A/chicken/Germany/AR1385/2015 (HPAIV H7N7) were mixed and the percentage ratios indicated on the X-axis. Identification of Cq values (results of triplicate analyses) obtained for each mixture sample by H7 specific RT-qPCRs is as follows: blue circles – LPAI H7; green triangles – HPAI H7 ‘Emsland’

Furthermore, we determined the ability of the H7 pathotyping RTqPCRs to detect mixtures of RNAs of LPAIV and HPAIV derived from the Emsland outbreak in Germany, 2015, and compared it to the M gene-specific generic RT-qPCR (Fig. 3d). Different concentrations of LP/HPAIV-mixtures (0, 0.1%, 1%, 10%, 50% and 100% LP) were generated, and HP H7 RNA was added to 100%. Both RNA species were detected by the specific RT-qPCRs in the mixtures, and the respective Cq values reflected the concentration of the RNA species in the mixtures (Fig. 3d). H7 LP RNA was not detected in the sample containing 100% H7 HP RNA, and vice versa, once more confirming the specificity of the pathotyping RT-qPCRs (Fig. 3d). Thus, these PCRs can be used to study the generation and co-circulation of H7 HPAIV from its LPAI precursor viruses.

Assessment of the diagnostic performance characteristics of the established RT-qPCRs was carried out with a collection of H7 AIV isolates (n = 48) and H7-positive field samples (n = 27) collected between 1999 and 2016. Samples were obtained from the virus repository of the German National Reference Laboratory for Avian Influenza at the Friedrich-Loeffler-Institut, Germany, or kindly provided by the OIE Reference Laboratory for Newcastle Disease and Avian Influenza in Italy, ISZVe, Padua, the Central Veterinary Research laboratory at Dubai, United Arab Emirates, the National Centre for Foreign Animal Disease, Winnipeg, Canada and the WHO Collaborating Centre, London, United Kingdom, under the patronage of the global influenza programme (Table 4). Amplificates produced from these viral RNAs by H7-specific RT-qPCR analysis were also further processed for sequence analysis using the H7-specific reverse primer mix (Table 2) for Sanger sequencing: Following agarose gel electrophoresis and amplicon purification using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) they were cycle-sequenced (BigDye Terminator v1.1 Cycle Sequencing Kit, Applied Biosystems, California, United States) and analysed on an ABI PRISM 3130 Genetic Analyzer (Life Technologies, Darmstadt, Germany) [10]. Partial HA sequences of the diagnostic samples are shown in the sequence alignment of Additional file 1: Figure S1; in all cases subtype H7 was confirmed. Pathotypes were assigned as based on the deduced amino acid sequence of the HACS according to the list of published H7 CS sequences (Additional file 1: Figure S1 and Table 4).
Table 4

Diagnostic performance characteristics of the H7 pathotyping RT-qPCRs using HP and LP influenza A subtype H7 virus isolates and field samples collected from different countries and poultry holdings or wild bird species, 1999–2016

No.

Sample ID

Type of sample

Accession Numbera

Subtype/ pathotype

PCR results (cq value)

M1.2

LP H7

HP H7 Italy

HP H7 Ems

1

A/duck/Potsdam/15/1980

I

AJ704797

H7N7 LP

17,03

NEG

NEG

NEG

2

A/duck/Potsdam/13/1980

I

SA

H7N7 LP

17,55

NEG

NEG

NEG

3

A/swan/Potsdam/64/1981

I

AM922155

H7N7 LP

20,07

NEG

NEG

NEG

4

A/turkey/Germany/R11/2001

I

AJ704812

H7N7 LP

18,89

12,74

NEG

NEG

5

A/mallard/NVP/1776–80/2003

I

NAV

H7N3 LP

25,3

16,41

NEG

NEG

6

A/mallard/NVP/41/2004

I

SA

H7N1 LP

15,44

12,49

NEG

NEG

7

A/mallard/Föhr/Wv190/2005

I

NAV

H7N7 LP

27,35

24,10

NEG

NEG

8

A/teal/Föhr/Wv180/2005

I

NAV

H7N2 LP

14,28

10,76

NEG

NEG

9

A/teal/Föhr/Wv177/2005

I

AM933237

H7N7 LP

24,41

21,76

NEG

NEG

10

A/mallard/Germany/R721/2006

I

SA

H7N7 LP

31,38

27,31

NEG

NEG

11

A/graylag goose/Germany/R752/2006

I

AM933236

H7N7 LP

26,15

17,27

NEG

NEG

12

A/mallard/Germany/R756/2006

I

SA

H7N4 LP

24,81

24,13

NEG

NEG

13

A/mute swan/Germany/R57/2006

I

EPI492518

H7N7 LP

27,73

24,20

NEG

NEG

14

A/mute swan/Germany/R901/2006

I

EPI359695

H7N1 LP

23,14

20,08

NEG

NEG

15

A/swan/Germany/736/2006

I

EPI492517

H7N4 LP

15,39

14,07

NEG

NEG

16

A/common pochard/Germany/R916/2006

I

SA

H7N7 LP

19,03

20,32

NEG

NEG

17

A/duck/Germany/R3129/2007

I

SA

H7N7 LP

15,34

11,59

NEG

NEG

18

A/sentinel-duck/Germany/SK207R/2007

I

NAV

H7N3 LP

27,64

22,09

NEG

NEG

19

A/mallard/Sko212-219 K/2007

I

SA

H7N3 LP

25,97

21,04

NEG

NEG

20

A/guineafowl/Germany/R2495/2007

I

AM930528

H7N3 LP

29,58

27,14

NEG

NEG

21

A/mallard/Germany/R192/2009

I

SA

H7N7 LP

14,65

13,28

NEG

NEG

22

A/turkey/Germany/R655/2009

F

EPI302173

H7N7 LP

13,34

11,76

NEG

NEG

23

A/nandu/Germany/AR142/2013

F

SA

H7N7 LP

28,35

28,90

NEG

NEG

24

A/turkey/Germany/AR502/2013

F

SA

H7N7 LP

18,67

19,12

NEG

NEG

25

A/turkey/Germany/AR618/2013

F

NAV

H7Nx LP

16,11

16,20

NEG

NEG

26

A/chicken/Germany/AR909/2013

F

SA

H7Nx LP

35,59

NEG

NEG

NEG

27

A/turkey/Germany/AR979/2013

F

NAV

H7Nx LP

25,59

21,79

NEG

NEG

28

A/environment/Germany/AR1251/2013

F

NAV

H7N LP

21,31

14,93

NEG

NEG

29

A/chicken/Germany/AR929/2015

F, EL

SA

H7N7 LP

30,39

30,02

NEG

NEG

30

A/chicken/Germany/AR930/2015

F, EL

SA

H7N7 LP

30,39

35,77

NEG

NEG

31

A/chicken/Germany/AR934/2015

F, EL

SA

H7N7 LP

30,07

32,88

NEG

NEG

32

A/chicken/Germany/AR943/2015

F, EL

SA

H7N7 LP

30,07

32,70

NEG

NEG

33

A/chicken/Germany/AR944/2015

F, EL

SA

H7N7 LP

30,07

31,03

NEG

NEG

34

A/chicken/Germany/AR945/2015

F, EL

SA

H7N7 LP

29,9

33,18

NEG

NEG

35

A/chicken/Germany/AR946/2015

F, EL

SA

H7N7 LP

29,9

33,32

NEG

NEG

36

A/duck/Germany/AR234/1/2016

F

SA

H7N7 LP

33,42

35,43

NEG

NEG

37

A/duck/Germany/AR2112/2016

F

NAV

H7N7 LP

36,17

NEG

NEG

NEG

38

A/duck/Germany/AR2868/2016

F

NAV

H7N7 LP

35,3

NEG

NEG

NEG

39

A/FPV/Rostock/45/1934

I

CY077420

H7N1 HP

17,25

NEG

NEG

13,94

40

A/chicken/Germany/“Taucha“/1979

I

SA

H7N7 HP

14,25

NEG

NEG

10,63

41

A/chicken/Germany/R28/2003

I

AJ704813

H7N7 HP

14,77

NEG

NEG

NEG

42

A/FPV/dutch/1927

I

NAV

H7N1 HP

16,52

NEG

NEG

32,14

43

A/chicken/Germany/AR1385/2015

F, EL

SA

H7N7 HP

18,76

NEG

NEG

19,01

44

A/chicken/Germany/AR1413/2015

F, EL

SA

H7N7 HP

29,9

NEG

NEG

35,48

45

A/chicken/Germany/AR1488/1/2015

F, EL

SA

H7N7 HP

29,31

NEG

NEG

22,72

46

A/environment/Germany/AR1536/2015

F, EL

SA

H7N7 HP

29,38

NEG

NEG

21,18

47

A/environment/Germany/AR1537/2015

F, EL

SA

H7N7 HP

29,38

NEG

NEG

25,7

48

A/environment/Germany/AR1539/2015

F, EL

SA

H7N7 HP

29,38

NEG

NEG

22,19

49

A/environment/Germany/AR1540/2015

F, EL

SA

H7N7 HP

29,38

NEG

NEG

24,69

50

A/environment/Germany/AR1541/2015

F, EL

SA

H7N7 HP

29,38

NEG

NEG

26,35

51

A/environment/Germany/AR1546/2015

F, EL

SA

H7N7 HP

30,12

NEG

NEG

25,19

52

A/turkey/Italy/472/1999

I

AJ704811

H7N1 LP

15,24

9,80

NEG

NEG

53

A/chicken/Italy/473/1999

I

EPI624438

H7N2 LP

13,73

10,71

NEG

NEG

54

A/turkey/Italy/2043/2003

I

CY022613, CY022615

H7N3 LP

24,34

21,45

NEG

NEG

55

A/duck/Italy/636/2003

I

NAV

H7N3 LP

22,05

20,49

NEG

NEG

56

A/chicken/Brescia/19/2002

I

AM922154

H7N1 HP

16,59

NEG

NEG

NEG

57

A/hen/Italy/444/1999

I

AJ704810

H7N1 HP

16,22

NEG

18,02

NEG

58

A/broiler/Italy/445/1999

I

AJ580353

H7N1 HP

17,02

NEG

16,35

NEG

59

A/turkey/Ireland/PV8/1995

I

AJ704799

H7N7 LP

16,19

13,07

NEG

NEG

60

A/houbara/Dubai/AR433/2014

I

SA

H7N1 LP

16,81

13,51

NEG

NEG

61

A/houbara/Dubai/AR434/2014

I

SA

H7N1 LP

14,67

11,27

NEG

NEG

62

A/houbara/Dubai/AR435/2014

I

SA

H7N1 LP

15,47

12,66

NEG

NEG

63

A/houbara/Dubai/AR436/2014

I

SA

H7N1 LP

12,23

9,23

NEG

NEG

64

A/houbara/Dubai/AR437/2014

I

SA

H7N1 LP

16,1

13,35

NEG

NEG

65

A/houbara/Dubai/AR438/2014

I

SA

H7N1 LP

13,71

10,08

NEG

NEG

66

A/peregrine falcon/Dubai/AR439/2014

I

SA

H7N1 LP

13,79

26,82

NEG

NEG

67

A/francolin/Dubai/AR440/2014

I

SA

H7N2 LP

15,85

17,84

NEG

NEG

68

A/wild bird/Dubai/AR3452/2014

F

SA

H7N1 LP

16,18

14,57

NEG

NEG

69

A/alexandria tyrode/T145/1948

I

SA

H7N1 HP

14,48

NEG

NEG

10

70

A/duck/Alberta/48/1976

I

SA

H7N3 LP

15,8

14,08

NEG

NEG

71

A/turkey/Ontario/18–1/2000

I

AF497552

H7N1 LP

28,61

NEG

NEG

NEG

72

A/mallard/Alberta/8734/2007

I

AM933238

H7N3 LP

18,63

NEG

NEG

NEG

73

A/chicken/BritishColumbia/CN-06/2004

I

KP055066

H7N3 HP

16,42

NEG

NEG

NEG

74

A/chicken/BritishColumbia/CN-07/2004

I

KP055076

H7N3 HP

24,71

NEG

NEG

NEG

75

A/Anhui/1/2013

I

AHZ60096

H7N9 LP

11,79

9,94

NEG

NEG

aSequences were obtained from the EpiFlu database of the Global Initiative on Sharing Avian Influenza Data (GISAID) and from GenBank at the National Center for Biotechnology Information (NCBI)

LP low pathogenicity, HP high pathogenicity, SA sequence shown in either Additional file 1: Figure S1 or Additional file 2: Figure S2, otherwise accession numbers are indicated, NAV sequence not available, neg no positive signal detected, I Isolate, F Field sample, F, EL field sample from recent outbreak in Germany

In total, 75 samples positive for AIV of subtype H7 were used. Based on nucleotide sequence analysis and/or IVPI, 49 samples were classified as LPAIV and 15 as HPAIV (Table 4, Additional file 1: Figure S1). They were of both historic and recent origin and mainly derived from European locations. Four samples originated from North America, nine from the United Arab Emirates/Dubai and one represented the Chinese LP H7N9 lineage. The samples mainly consisted of egg-derived isolates or native combined oropharyngeal and cloacal swabs obtained from poultry or wild birds. Seven samples were taken from the environment during a recent HPAIV outbreak in a chicken layer holding in Germany (referred to as ‘Emsland’). For the H7 LP RT-qPCR, 48 out of 56 samples were correctly identified as LP (Table 4, Fig. 4), also including the Chinese LP H7N9 reference virus. Three historic LP isolates (Table 4, nos. 1–3) and the two North American LP H7 viruses (Table 4, nos. 71–72) were not detected despite high viral loads. Sequence mismatches affected binding of either probe and/or primers in these cases. In three further samples (Table 4, nos. 26, 37, 38) low virus loads were detected by the generic M RT-qPCR and these were missed by the H7 LP specific RT-qPCR. However, in most samples, the H7 LP specific RT-qPCR proved to be more sensitive as compared to the generic M specific one (Table 4, Fig. 4). Since none of the HP H7 positive samples cross reacted in the H7 LP RT-qPCR, complete specificity was achieved.
Fig. 4

Sequencing-indpendent pathotyping of isolates and clinical samples of avian influenza subtype H7 viruses by real-time RT-PCRs (RT-qPCR). Sample numbers refer to the identification of viruses in Table 4. Cq values generated for each sample by the influenza A virus-generic M1.2 RT-qPCR are depicted as blue dots. Identification of Cq values obtained for each sample by H7 specific RT-qPCRs is as follows: black diamonds – LPAI H7; green triangles – HPAI H7. ‘Emsland’; red squares – HPAI H7 ‘Italy’

A total of 19 samples harbored HP H7 RNA. None of them was detected by the LP specific RT-qPCR (Table 4, Fig. 4). Two isolates originating from the Italian HP H7N1 epizootic of 1999 were detected by the H7 HP ‘Italy’-specific RT-qPCR (Table 4, nos. 57–58); no further viruses were identified by this PCR. This includes another HPAIV H7N1 isolate from Italy originating from 2002 and distinguished from the 1999 viruses by 13 mutations in the primer and probe binding sites (Table 4, no. 56). Thus, the ‘Italy 99’ RT-qPCR proved to be highly lineage-specific. The second H7 HP RT-qPCR aimed at detecting HP AIV related to the most recent outbreak in Germany in 2015. All nine samples classified to harbor HP H7 were identified by this PCR with a high sensitivity (Table 4, nos. 43–51). At similarily high sensitivity four historic European HP H7 viruses (Table 4, nos. 39, 40, 42, 69), but none of the Italian HP viruses, or an isolate (Table 4, no. 41) representing the large HP H7N7 epizootic affecting the Netherlands, Belgium and Germany in 2003, reacted with either of the two HP specific RT-qPCRs. No cross reactivity to any of the LP H7 samples was detected indicating excellent performance values regarding sensitivity and specificity. Due to our results, the threshold distinguishing reliably between positive and negative samples was set at Cq = 38.

Discussion

Although not all of the LP and HP H7 samples did show a positive signal with the respective RT-qPCR due to mismatches in the probe binding regions, the newly developed set of primers produced a sequenceable amplificate even of those virus strains. Consequently, pathotype confirmation of a H7 positive sample that tested negative by the LP and HP RT-qPCRs is still possible by nucleotide sequence analysis using the amplificate produced by these RT-qPCRs. In this respect, the newly developed RT-qPCRs resemble the one introduced by Slomka et al. [19] which also spanned the H7 HACS but its probe targeted a highly conserved sequence stretch outside the CS.

Conclusion

The pathotype-specific RT-qPCRs developed here for avian influenza viruses of subtype H7 proved to be a useful, sensitive and highly specific alternative to nucleotide sequence analysis for the characterization of LPAI and HPAI H7 viruses of European origin. Proper detection of HP H7 viruses required knowledge of the HACS of the specific lineage, and specific probes are to be used for each distinct lineage. Thus, initial characterization of an H7 HP virus still depends on nucleotide sequence analysis of its HACS. However, in case of on-going spread of the identified HP H7 lineage a lineage-specific probe can then be used in a pathotyping RT-qPCR for the swift examination and pathotyping of further cases and outbreaks. Furthermore, the LP LNA probe introduced here was universally usuable for Eurasian LP H7 viruses circulating in Europe over the past decade. In conclusion, these here described RT-qPCRs complement a sequencing-independent approach, and allow a high-speed pathotyping helping the authorities to install necessary control measures in time.

Abbreviations

AIV: 

Avian influenza virus

CS: 

Cleavage site

GISAID: 

Global initiative on sharing Avian influenza data

gs/GD: 

Goose/Guangdong

HA: 

Hemagglutinin

HPAIV: 

Highly pathogenic avian influenza virus

IBV: 

Infectious bronchitis virus

IVPI: 

Intravenous pathogenicity index

LPAIV: 

Low pathogenic avian influenza virus

NA: 

Neuraminidase

NDV: 

Newcastle disease virus

RT-qPCR: 

Reverse transcription real-time PCR

Declarations

Acknowledgements

The authors thank Aline Maksimov, Diana Wessler and Mahmoud Naguib for excellent support. We are grateful to Christine Luttermann and her team for conducting the Sanger sequencing analyses, and we wish to acknowledge veterinarians and diagnosticians in Germany for submitting diagnostic samples. We are grateful to colleagues from various research institutions as mentioned in the text who made H7 samples and/or isolates available to the FLI virus repository. We kindly acknowledge all researchers who made available sequences, used in this study, to the EpiFlu database of GISAID.

Funding

The study was funded by an intramural grant of the Federal Ministry for Food and Agriculture to the Friedrich-Loeffler-Institut.

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Authors’ contributions

AG and TCH conceived the study. AG carried out the experiments. AG, MB and TCH analysed and interpreted the data. AG drafted the manuscript. All authors amended and approved the final version of the manuscript.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors that they have no competing interests.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Friedrich Loeffler Institute, Institute of Diagnostic Virology

References

  1. Spackman E. A brief introduction to the avian influenza virus. Methods Mol Biol. 2008;436:1–6.PubMedGoogle Scholar
  2. Cheung TK, Poon LL. Biology of influenza a virus. Ann N Y Acad Sci. 2007;1102:1–25.View ArticlePubMedGoogle Scholar
  3. Webster RG, et al. Evolution and ecology of influenza a viruses. Microbiol Rev. 1992;56(1):152–79.PubMedPubMed CentralGoogle Scholar
  4. Alexander DJ. An overview of the epidemiology of avian influenza. Vaccine. 2007;25(30):5637–44.View ArticlePubMedGoogle Scholar
  5. (OIE), W.O.f.A.H., Avian Influenza. Chapter 10.4. Article 10.4.1. Available from: http://web.oie.int/eng/normes/mcode/en_chapitre_1.10.4.pdf. 2010.Google Scholar
  6. (OIE/FAO), W.O.f.A.H.F.a.A.O.o.t.U.N., Network of expertise on animal influenza. Influenza a cleavage sites. Paris/Rome: OIE/FAO; 2015. [Accessed 01 Dec 2016] Available from: http://www.offlu.net/fileadmin/home/en/resource-centre/pdf/Influenza_A_Cleavage_Sites.pdf. 2015.Google Scholar
  7. Fereidouni SR, et al. Rapid molecular subtyping by reverse transcription polymerase chain reaction of the neuraminidase gene of avian influenza a viruses. Vet Microbiol. 2009;135(3–4):253–60.View ArticlePubMedGoogle Scholar
  8. Leijon M, et al. Rapid PCR-based molecular pathotyping of H5 and H7 avian influenza viruses. J Clin Microbiol. 2011;49(11):3860–73.View ArticlePubMedPubMed CentralGoogle Scholar
  9. Hoffmann B, et al. Rapid and highly sensitive pathotyping of avian influenza a H5N1 virus by using real-time reverse transcription-PCR. J Clin Microbiol. 2007;45(2):600–3.View ArticlePubMedGoogle Scholar
  10. Naguib MM, et al. Novel real-time PCR-based patho- and phylotyping of potentially zoonotic avian influenza a subtype H5 viruses at risk of incursion into Europe in 2017. Euro Surveill. 2017;22(1). doi: http://dx.doi.org/10.2807/1560-7917.ES.2017.22.1.30435.
  11. (WHO), W.H.O., WHO RISK ASSESSMENT of human infections with avian influenza a(H7N9) virus. [Accessed 23 Feb 2015] Available from: http://www.who.int/influenza/human_animal_interface/influenza_h7n9/RiskAssessment_H7N9_23Feb20115.pdf?ua=1. 2015.Google Scholar
  12. Li Q, et al. Epidemiology of human infections with avian influenza a(H7N9) virus in China. N Engl J Med. 2014;370(6):520–32.View ArticlePubMedGoogle Scholar
  13. Cima G. Another H7N9 epidemic, with possible HPAI isolates. Am J Vet Res. 2017. Available from: https://www.avma.org/News/JAVMANews/Pages/170415l.aspx.
  14. EC, E.c., Annual report for avian influenza in poultry and wild birds in member states of the European Union in 2015; Available from: https://ec.europa.eu/food/sites/food/files/ad_control-measures_ai_surv-rslt_pltry-wld-brds_2015.pdf. 2015.
  15. Steinhauer DA. Role of hemagglutinin cleavage for the pathogenicity of influenza virus. Virology. 1999;258(1):1–20.View ArticlePubMedGoogle Scholar
  16. Bosch FX, et al. Proteolytic cleavage of influenza virus hemagglutinins: primary structure of the connecting peptide between HA1 and HA2 determines proteolytic cleavability and pathogenicity of avian influenza viruses. Virology. 1981;113(2):725–35.View ArticlePubMedGoogle Scholar
  17. Gall A, et al. Universal primer set for amplification and sequencing of HA0 cleavage sites of all influenza a viruses. J Clin Microbiol. 2008;46(8):2561–7.View ArticlePubMedPubMed CentralGoogle Scholar
  18. Hoffmann B, et al. New real-time reverse transcriptase polymerase chain reactions facilitate detection and differentiation of novel a/H1N1 influenza virus in porcine and human samples. Berl Munch Tierarztl Wochenschr. 2010;123(7–8):286–92.PubMedGoogle Scholar
  19. Slomka MJ, et al. Validated real time reverse transcriptase PCR methods for the diagnosis and pathotyping of Eurasian H7 avian influenza viruses. Influenza Other Respir Viruses. 2009;3(4):151–64.View ArticlePubMedPubMed CentralGoogle Scholar
  20. OIE, W.O.f.A.H., Update on highly pathogenic avian influenza in animals (type H5 and H7); Available from: http://www.oie.int/animal-health-in-the-world/update-on-avian-influenza/2015/.2017.

Copyright

© The Author(s). 2017

Advertisement