Skip to main content

Advertisement

Table 2 Primers and probes used for sequencing-independent pathotyping of Eurasian avian influenza A subtype H7 viruses by real time RT-PCR

From: Real-time reverse transcription PCR-based sequencing-independent pathotyping of Eurasian avian influenza A viruses of subtype H7

Primer/Probe ID Sequence (5′ to 3′) Location Amplicon size Accession numbera
H7_CS-F1 TGMTGCTRGCAACAGGAAT 989–1007 107b KX979524
H7_CS-F2 N TGCTACTRGCAACAGGGAT 989–1007
H7_CS-F3 TGMTGCTGGCAACWGGRAT 968–986
H7_CS-R1N CGTCAATKAGRCCTTCCCA 1096–1078
H7_CS-R2N TCCATTTTCWATRAAACCYGC 1056–1036
H7_CS-R3 CATCAAYCAGACCYTCCCA 1056–1076
H7_CS-LP-FAM C + C + AAAG + GGA + A + GAG + GC 1026–1040 KY676327.1
H7_CS-HP_EMS-FAM CCAAAGAGAAAGAGAAGAGGCC 1027–1046 120c AB438941
H7_CS-HP_IT-FAM TTCCAAAAGGATCGCGTGTGAGGA 1004–1027 KF493066
  1. aAccession number of sequence/virus used to position the oligonucleotide along the HA gene
  2. bsize applied to LP sequences
  3. csize applied to HP sequences
  4. + indicates that the following position constituted a “locked” nucleotide (LNA)