Skip to content


  • Research
  • Open Access

Herpes simplex virus 1 infection dampens the immediate early antiviral innate immunity signaling from peroxisomes by tegument protein VP16

Virology Journal201714:35

Received: 6 December 2016

Accepted: 15 February 2017

Published: 21 February 2017



Herpes simplex virus 1 (HSV-1) is an archetypal member of the alphaherpesvirus subfamily with a large genome encoding over 80 proteins, many of which play a critical role in virus-host interactions and immune modulation. Upon viral infections, the host cells activate innate immune responses to restrict their replications. Peroxisomes, which have long been defined to regulate metabolic activities, are reported to be important signaling platforms for antiviral innate immunity. It has been verified that signaling from peroxisomal MAVS (MAVS-Pex) triggers a rapid interferon (IFN) independent IFN-stimulated genes (ISGs) production against invading pathogens. However, little is known about the interaction between DNA viruses such as HSV-1 and the MAVS-Pex mediated signaling.


HSV-1 could activate the MAVS-Pex signaling pathway at a low multiplicity of infection (MOI), while infection at a high MOI dampens MAVS-Pex induced immediately early ISGs production. A high-throughput screen assay reveals that HSV-1 tegument protein VP16 inhibits the immediate early ISGs expression downstream of MAVS-Pex signaling. Moreover, the expression of ISGs was recovered when VP16 was knockdown with its specific short hairpin RNA.


HSV-1 blocks MAVS-Pex mediated early ISGs production through VP16 to dampen the immediate early antiviral innate immunity signaling from peroxisomes.


HSV-1VP16MAVS-PexImmune evasion


The host innate immune system plays an important role in detecting the invading pathogens. Conserved pathogen-associated molecular patterns from viruses are initially recognized by multiple immune sensors that are referred to as pattern recognition receptors (PRRs) [13]. Besides Toll-like receptors in the cellular membrane or endosome and Nod-like receptors in the cytoplasm, the retinoic acid-inducible gene I (RIG-I)-like receptors (RLRs) such as RIG-I and melanoma differentiation-associated gene 5 (MDA-5) are able to detect 5′-triphosphate-containing short double-stranded RNA (dsRNA) and long dsRNA respectively and activate the expression of type I interferons (IFNs) and IFN-stimulated genes (ISGs) [48]. RLRs can detect both viral RNA and RNA polymerase III-mediated transcription of microbial DNA [810]. Additionally, MDA-5 was reported to be a primary mediator of HSV recognition using small interfering RNA knockdown in HSV-infected macrophages [11]. Upon recognition of viral RNA, RIG-I and MDA-5 interact with the mitochondrial antiviral signaling protein (MAVS, also known as IPS-1, VISA, and CARDIF), which then leads to the production of IFNs and ISGs [12, 13].

As the adaptor protein downstream of the RLR-dependent signaling pathway, MAVS was reported to locate on mitochondria, peroxisomes and mitochondria-associated membranes of the endoplasmic reticulum [1416]. Peroxisomes have been established to be metabolic regulation organelles for a long time, which control the metabolism of lipids and reactive oxygen species [1719]. Surprisingly, these organelles were also revealed to be important signaling platforms for antiviral innate immunity. Upon viral infection, peroxisomal MAVS (MAVS-Pex) triggers an immediate early induction of ISGs, which is type I IFN-independent, whereas mitochondrial MAVS shows a delayed and sustained antiviral effect based on the induction of type I IFNs and ISGs [14]. In addition, MAVS-Pex is also identified to activate type III IFN expression [20].

Herpes Simplex Virus 1 (HSV-1) is an archetypal member of the alphaherpesvirinae subfamily, which encodes over 80 proteins. VP16, a 65-kDa tegument protein of HSV-1, was reported to have various functions, including transcriptional activation of viral immediate early genes, downregulation of the virion host shutoff protein and participation in viral egress downstream of the initial envelopment [2124]. Furthermore, our previous study has demonstrated that VP16 also downregulates the production of IFN-β in RLR signaling pathway [25].

A variety of ISGs function as antiviral effectors. Viperin (also known as cig5 or RASD2), a highly conserved and well-characterized ISG protein, limits the replication of many DNA and RNA viruses [16, 2637]. To survive within the infected host, HSV-1 has evolved multiple strategies to counteract host antiviral innate immune responses through its numerous proteins [25, 3844]. In this study, we demonstrated for the first time that HSV-1 tegument protein VP16 dampened the MAVS-Pex signaling and the expression of the immediate early ISGs, such as viperin.


HSV-1 infection triggers a MAVS-Pex-dependent early induction of viperin

Previous study demonstrated that MAVS-Pex signaling could be activated by RNA viruses, such as reovirus and influenza virus [14]. However, whether DNA viruses such as HSV-1 could activate the MAVS-Pex signaling has not been demonstrated. Firstly, we investigated whether HSV-1 could induce the activation of the immediate early ISG gene viperin downstream of MAVS-Pex. As mentioned above, activation of mitochondrial MAVS plays an important role on the production of type I IFN, while activation of peroxisomal MAVS could trigger the production of type III IFN, both of which induce the expression of ISGs. Therefore, Brefeldin A (BFA) was applied in our experiments to disrupt type I and III IFNs secretion, thus excluding the viperin production from type I and III IFNs [14]. As shown in Fig. 1a, supernatants from wild-type (WT) HSV-1 infected cells could trigger the activation of viperin promoter, while pretreatment with BFA blocked viperin promoter activation from IFNs. HEK293 cells were pretreated with BFA and then infected with HSV-1. At 18 h post infection, cells were harvested and subjected to quantitative RT-PCR (qRT-PCR) analysis to determine viperin mRNA level. Our results showed that HSV-1 infection could successfully enhance viperin mRNA level independent of type I and III IFNs (Fig. 1b). In addition, Western blot (WB) assays were performed and similar results were obtained (Fig. 1c). To further demonstrate that the immediate early viperin induction triggered by HSV-1 infection is mediated by MAVS-Pex, we performed the dual-luciferase reporter (DLR) experiment based on mouse viperin luciferase reporter Vig1-Luc in MAVS-KO and WT MEF cells. The results showed that HSV-1 infection triggered the induction of viperin in BFA-treated WT MEF cells, but not in MAVS-KO MEF cells, which indicated that the immediate early viperin expression induced by HSV-1 infection depended on MAVS-Pex (Fig. 1d). Taken together, these results demonstrated that HSV-1 could trigger the MAVS-Pex-dependent immediate early induction of viperin.
Figure 1
Fig. 1

HSV-1 infection triggers a MAVS-Pex-dependent early induction of viperin. a HEK293 cells were pretreated with or without 50 ng/ml BFA and infected with or without WT HSV-1 at an MOI of 0.1 or 0.5. At 2 h post infection, the supernatants were discarded and replaced with fresh media containing BFA for 18 h. Then, the supernatants were collected and added to Viperin-Luc and pRL-TK transfected cells for DLR analysis. (b and c) HEK293 cells were pretreated with 50 ng/ml BFA and infected with or without WT HSV-1 at an MOI of 0.1 (+) or 0.5 (++). At 2 h post infection, the supernatants were discarded and replaced with fresh media containing BFA. At 18 h post infection, cells were harvested and subjected to RT-PCR (b) and WB analysis with anti-viperin antibody (c). d MAVS-KO and WT MEF cells were pretreated with 100 ng/ml BFA and infected with or without WT HSV-1 at an MOI of 0.1 (+) or 0.5 (++). At 2 h post infection, the supernatants were discarded and replaced with fresh media and the cells were transfected with Vig1-Luc and pRL-TK for 18 h in the presence of BFA and subjected to DLR analysis. The data represent results from one of the triplicate experiments

HSV-1 infection at a high multiplicity of infection (MOI) dampens the immediate early induction of viperin triggered by MAVS-Pex

As HSV-1 has evolved multiple strategies to counteract host innate immune system, we further determine the role of HSV-1 infection on the early antiviral signals triggered by MAVS-Pex. Firstly, a YFP-tagged MAVS-Pex plasmid (MAVS-Pex-YFP) was transfected into MEF cells to examine its subcellular localization, where the peroxisomes were marked by a DsRed allele containing a type 1 peroxisomal targeting signal (PTS1). As shown in Fig. 2a, MAVS-Pex-YFP is exclusively located on peroxisomes. Meanwhile, we confirmed that pretreatment with BFA was capable of disrupting IFN secretion induced by MAVS-Pex, thus excluding the viperin production from IFN (Fig. 2b). We next examined whether HSV-1 infection could affect MAVS-Pex-induced immediate early induction of viperin. HEK293 cells were pretreated with BFA and infected with WT HSV-1 at a high MOI of 5 prior to transfection of the indicated plasmids. Cells were subjected to qRT-PCR analysis 18 h post transfection. Our results showed that HSV-1 successfully blocked activation of viperin mRNA induced by MAVS-Pex-HA (Fig. 2c). Additionally, WB assays were performed to verify the result (Fig. 2d). In conclusion, the immediate early induction of viperin triggered by MAVS-Pex could be dampened by HSV-1 infection at a high MOI.
Figure 2
Fig. 2

HSV-1 infection at a high MOI dampens the immediate early induction of viperin triggered by MAVS-Pex. a MEF cells were transfected with MAVS-Pex-YFP, along with PTS1-DsRed plasmid for 36 h. The images were obtained by fluorescence microscopy using a 20× objective. b HEK293 cells were pretreated with or without 50 ng/ml BFA and transfected with empty vector or MAVS-Pex-HA plasmid for 18 h. Then, the supernatants were collected and added to Viperin-Luc and pRL-TK transfected cells for DLR analysis. (c and d) HEK293 cells were pretreated with 50 ng/ml BFA and infected with or without WT HSV-1 at an MOI of 5. At 2 h post infection, the cells were transfected with the indicated plasmids in the presence of BFA. Eighteen hours post transfection, cells were harvested and subjected to RT-PCR (c) and WB (d) analysis. The data represent results from one of the triplicate experiments

VP16 inhibits the early induction of viperin from MAVS-Pex

The data above led us to hypothesize that at least one of the HSV-1 proteins was involved in inhibiting MAVS-Pex mediated early induction of viperin. A high-throughput qRT-PCR screen assay was performed. HEK293 cells were pretreated with BFA and co-transfected with the individual HSV-1 protein expression plasmid [45]. As a result, the tegument protein VP16 was found to most effectively inhibit MAVS-Pex induced viperin mRNA expression (Fig. 3a). To further confirm the result, HEK293 cells pretreated with BFA were transfected with empty vector, MAVS-Pex-HA plasmid, or Flag-tagged VP16 plasmid together with the MAVS-Pex-HA plasmid as indicated. At 18 h post transfection, cells were harvested and subjected to WB analysis. As a result, MAVS-Pex-induced expression of viperin was strongly inhibited by VP16 (Fig. 3b). Collectively, these results demonstrated that VP16 could inhibit the immediate early induction of viperin from MAVS-Pex.
Figure 3
Fig. 3

VP16 inhibits the early induction of viperin from MAVS-Pex. a HEK293 cells were pretreated with 50 ng/ml BFA and transfected with empty vector, MAVS-Pex-HA and individual HSV-1 protein expression plasmid in the presence of BFA. At 18 h post transfection, cells were harvested and subjected to qRT-PCR analysis. b HEK293 cells were pretreated with 50 ng/ml BFA and transfected with MAVS-Pex-HA and VP16-Flag plasmids as indicated in the presence of BFA. At 18 h post transfection, cells were harvested and subjected to WB analysis with anti-viperin antibody. The data represent results from one of the triplicate experiments

Knockdown of VP16 restores the immediate early innate antiviral signaling triggered by MAVS-Pex or HSV-1 infection

We next attempted to evaluate whether the loss of HSV-1 VP16 expression would affect its ability to inhibit MAVS-Pex mediated early induction of viperin. However, UL48, which encodes the VP16 protein, is an essential gene for HSV-1 and the deficiency of it was reported to display a lethal impact on the replication and infection of HSV-1 [22]. Therefore, a short hairpin RNA (shRNA) specific for VP16 (shVP16) or a scrambled shRNA as control (shNC) were constructed. Firstly, we evaluated the knockdown effect of shVP16 in HEK293T cells (Fig. 4a). Then, HEK293 cells were transfected with shVP16 or shNC to screen for stable transfection cell lines. To rule out the possibility that the stable transfection of shVP16 alone altered viperin expression, we tested the endogenous expression of viperin in HEK293, HEK293-shNC and HEK293 shVP16 cells, and the WB result showed that the endogenous expression level of viperin in HEK293-shVP16 cells was similar to that in HEK293 and HEK293-shNC cells (Fig. 4b). Next, as shown in Fig. 4c, the induction of viperin mRNA was decreased in HEK293 shNC cells co-transfected with VP16-Flag and MAVS-Pex-HA, while in HEK293 shVP16 cells the induction of viperin mRNA was recovered. The WB assays were also performed and similar results were obtained (Fig. 4d). Furthermore, we also performed qRT-PCR analysis to explore the effect of VP16 on other immediate early ISGs mediated by MAVS-Pex. As shown in Fig. 4e, MAVS-Pex could induce other immediate early ISGs while VP16 inhibited all these ISGs (Fig. 4e). On the other hand, we investigated whether knockdown of VP16 would affect the induction of the immediate early ISGs during HSV-1 infection. HEK293 cells were pretreated with BFA and then infected with or without WT HSV-1 at an MOI of 0.5 or 1. At 18 h post infection, cells were harvested and subjected to qRT-PCR analysis. The result showed that knockdown of VP16 restored the expression of viperin dampened by HSV-1 infection at the MOI of 1 (Fig. 4f). Meanwhile, similar result was obtained in WB analysis (Fig. 4g). Moreover, as shown in Fig. 4h, HSV-1 activated other immediate early ISGs downstream of MAVS-Pex at an MOI of 0.5 and dampened all these ISGs by VP16 at the MOI of 1. In conclusion, knockdown of VP16 restored the induction of immediate early ISGs triggered by MAVS-Pex or HSV-1 infection. Therefore, during HSV-1 early infection, VP16, as an abundant tegument protein, was shown to play a major role in dampening the immediate early antiviral signaling from peroxisomes and contributing to the early-stage survival during HSV-1 infection.
Figure 4
Fig. 4

Knockdown of VP16 restores the immediate early innate antiviral signaling triggered by MAVS-Pex or HSV-1 infection. a HEK293T cells were transfected with VP16-Flag, shNC or shRNA-VP16 as indicated for 36 h and subjected to WB analysis with anti-Flag antibody. b WT HEK293, shNC and shVP16-expressing HEK293 cells were subjected to WB analysis with anti-viperin antibody. (c, d and e) ShNC and shVP16-expressing HEK293 cells were pretreated with 50 ng/ml BFA and transfected with the indicated plasmids for 18 h in the presence of BFA, and subjected to RT-PCR (c), WB (d) and qRT-PCR (e) analysis. (f, g and h) HEK293 cells were pretreated with 50 ng/ml BFA and infected with or without WT HSV-1 at an MOI of 0.5 (+) or 1 (++). At 2 h post infection, cells were transfected with shNC or shVP16 plasmids as indicated in the presence of BFA. At 18 h post transfection, cells were harvested and subjected to RT-PCR (f), WB (g) and qRT-PCR (h) analysis. The data represent results from one of the triplicate experiments. Statistical analysis was performed using Student’s T-test with the GraphPad Prism 5.0 software. (* 0.01 < P<0.05; ** 0.001 < P<0.01; *** 0.0001 < P<0.001)


As the first line of defense against infectious threats, the innate immune system represents a conserved role in response to virus invasion and achieves their detections through PRRs. In RLRs signaling pathway, MAVS was originally reported to reside on mitochondria and bound to RLRs to initiate the downstream activation of NF-κB and interferon regulatory factors (IRFs) [16], which then translocated to the nucleus and activated the transcription of IFNs and ISGs. Nevertheless, MAVS was also reported to reside on peroxisomes, where it could trigger a rapid, IFN-independent ISG response, completely different from that of the mitochondrial MAVS [14].

As a double-strand DNA virus, HSV-1 evolved multiple mechanisms to evade the host innate immunity and establish its infection [46]. The virion host shutoff protein blocks cellular antiviral proteins, like tetherin, viperin, and zinc finger antiviral protein, by targeting their mRNA for degradation [4749]. Us11, an RNA binding tegument protein, interferes with the interaction between MAVS and RIG-I or MDA-5, thus dampens IRF3 activation and IFN production [38]. UL36, a ubiquitin-specific protease, inhibits IFN production by deubiquitinating TRAF3 to prevent recruitment of TBK1 [40]. Us3, which hyperphosphorylates IRF3 and p65, blocks their nuclear translocation and thus down regulates IFN-β production [41]. ICP0, an E3 ubiquitin ligase, disrupts NF-κB activation by abrogating the nuclear translocation of p65 and degrading p50 through ubiquitin-proteasome pathway [42]. ICP34.5, best known for its ability to inhibit the IFN-inducible kinase PKR, also dampens IFN production by binding and sequestering TBK-1, which phosphorylates IRF3 [50]. VP24, a serine protease of HSV-1, blocks DNA sensing signal pathway via abrogating the interaction between TBK1 and IRF3 [51].

Although there are plenty of HSV-1 proteins which block the IFN-β signaling pathway, the role of HSV-1 on the MAVS-Pex signaling has not been reported. Here we demonstrate for the first time that HSV-1 is able to activate the early antiviral signaling from peroxisomes. VP16, which is encoded by UL48 gene, has various functions in viral growth and infection. Our previous study showed that VP16 could abrogate the production of IFN-β, which presented a critical role of VP16 in mitochondrial MAVS signaling [25]. In this present study, we demonstrated another important effect of VP16 to abrogate the early expression of ISGs in the IFN-independent MAVS-Pex signaling pathway, which was characterized by viperin. As an abundant tegument protein, VP16 was released into host cells upon infection, dampened the immediate early antiviral immunity from peroxisomes in host cells and facilitated the proliferation of HSV-1. In addition, we found that VP16 could also inhibit the activation of viperin promoter induced by IRF3 and IRF1, two central regulators of IFN independent ISG expression which act downstream of MAVS-Pex (data not shown). And previous studies in our lab have reported that VP16 interacted with the CREB binding protein (CBP) coactivator and efficiently inhibited the formation of the transcriptional complexes IRF-3-CBP [25]. Therefore, we hypothesized that VP16 might act downstream of MAVS-Pex through a similar mechanism, interacting with coactivators of IRFs, but not direct on MAVS-Pex. However, until now the signal pathway downstream of MAVS-Pex is still largely unknown, so identification of VP16 target in the MAVS-Pex pathway and revealing the underlying molecular mechanisms require further investigation.


In summary, our studies define for the first time the contribution of HSV-1 tegument protein VP16 in the evasion of the immediate early antiviral response through MAVS-Pex signaling. This finding leads to a better understanding of the mechanisms of VP16 in dampening the host antiviral signaling and uncovers a new method of HSV-1 invasion against early-stage defense in host cells.


Cells, viruses, antibodies and reagents

HEK293, MEF and HEK293T cells were grown in Dulbecco’s modified minimal essential medium (DMEM) (Gibco-BRL) supplemented with 10% fetal bovine serum (FBS) as described previously [38, 52]. The WT HSV-1 F strain virus was propagated in Vero cells as described previously [38]. Rabbit anti-UL42 polyclonal antibody was made by GL Biochem Ltd. (Shanghai, China). Mouse anti-HA monoclonal antibody (mAb), anti-Flag mAb and anti-β-actin mAb were purchased from Abmart (Shanghai, China). Mouse anti-VP16 mAb was purchased from Santa Cruz Biotechnology (CA, USA). Rabbit anti-viperin polyclonal antibody was purchased from Abcam (Cambridge, MA, USA). BFA was purchased from Selleck (TX, USA). MAVS-KO MEF cells were provided by Dr. Chen Wang.

Plasmid construction

All enzymes used for cloning procedures were purchased from Vazyme (Nanjing, China). MAVS-Pex-YFP and MAVS-Pex-HA plasmids were subclones from MAVS-Pex-GFP (Addgene, MA, USA). Renilla luciferase plasmid pRL-TK (expressing thymidine kinase [TK]) was purchased from Promega (Madison, WI, USA). Oligonucleotides encoding shRNA-VP16 was synthesized and inserted into the pSuper.retro.puro vector (Oligoengine, LA, USA). Viperin reporter plasmids Viperin-Luc and Vig1-Luc were gifts from Dr. Katherine A. Fitzgerald. Plasmid PTS1-DsRed was a gift from Dr. Jonathan C. Kagan.

Transfection, BFA treatment and DLR assay

MEF cells were transfected with Lipofectamine® LTX (Invitrogen, CA, USA) according to the manufacturers’ recommendations. HEK293 cells were preincubated with 50 ng/ml BFA and infected with or without WT HSV-1 in the presence of BFA. At 2 h post infection, the supernatants were discarded and replaced by cell culture containing 50 ng/ml BFA, and cells were cotransfected with viperin luciferase reporter plasmid Viperin-Luc and internal control pRL-TK, with or without indicated plasmids in the presence of BFA, by standard calcium phosphate precipitation [53]. Luciferase assays were performed with a dual-specific luciferase assay kit (Promega) as previously described [38, 44].

RNA isolation, qRT-PCR

Total RNA was extracted from HEK293 cells with TRIzol (Invitrogen, CA, USA) according to the manufacturer’s manual. Samples were digested with DNase I and subjected to reverse transcription. The cDNA was used as a template for qRT-PCR to detect the accumulation of indicated mRNA as previously described [44]. The primers used for RT-PCR analysis are as follows: Viperin tggtgaggttctgcaaagtag (forward) and tcacaggagatagcgagaatgtc (reverse), GAPDH tgacctcaactacatggtttacatgt (forward) and agggatctcgctcctggaa (reverse).

Western blot analysis

WB analysis was performed as previously described [38, 52].

Statistical analysis

Data are represented as mean ± SD when indicated, and Student’s T-test was used for all statistical analyses with the GraphPad Prism 5.0 software. Differences between groups were considered significant when P-value was <0.05.



Brefeldin A


Dual-luciferase reporter


Herpes simplex virus 1


IFN-stimulated gene


Mitochondrial antiviral signaling protein


Peroxisomal MAVS


Multiplicity of infection



We thank Dr. Katherine A. Fitzgerald for viperin reporter plasmids, Dr. Chen Wang for MAVS-KO MEF cells, and Dr. Jonathan C. Kagan for PTS1-DsRed plasmid. This work was supported by grants from the National Natural Science Foundation of China (81371795 and 81571974) and Innovative Research Team in Soochow University (PCSIRT, IRT 1075).

Authors’ contributions

CZ and CS conducted the experiments and drafted the manuscript. CZ provided overall supervision and financial support and edited the manuscript. Both authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

Institutes of Biology and Medical Sciences, Soochow University, Suzhou, China
Department of Microbiology, Immunology and Infectious Diseases, University of Calgary, Calgary, Canada


  1. Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity. Cell. 2006;124:783–801.View ArticlePubMedGoogle Scholar
  2. Beutler B, Eidenschenk C, Crozat K, Imler JL, Takeuchi O, Hoffmann JA, Akira S. Genetic analysis of resistance to viral infection. Nat Rev Immunol. 2007;7:753–66.View ArticlePubMedGoogle Scholar
  3. Medzhitov R. Recognition of microorganisms and activation of the immune response. Nature. 2007;449:819–26.View ArticlePubMedGoogle Scholar
  4. Pichlmair A, Schulz O, Tan CP, Naslund TI, Liljestrom P, Weber F, Reis e Sousa C. RIG-I-mediated antiviral responses to single-stranded RNA bearing 5′-phosphates. Science. 2006;314:997–1001.View ArticlePubMedGoogle Scholar
  5. Rehwinkel J, Tan CP, Goubau D, Schulz O, Pichlmair A, Bier K, Robb N, Vreede F, Barclay W, Fodor E, Reis e Sousa C. RIG-I detects viral genomic RNA during negative-strand RNA virus infection. Cell. 2010;140:397–408.View ArticlePubMedGoogle Scholar
  6. Yoneyama M, Onomoto K, Jogi M, Akaboshi T, Fujita T. Viral RNA detection by RIG-I-like receptors. Curr Opin Immunol. 2015;32:48–53.View ArticlePubMedGoogle Scholar
  7. Nakhaei P, Genin P, Civas A, Hiscott J. RIG-I-like receptors: sensing and responding to RNA virus infection. Semin Immunol. 2009;21:215–22.View ArticlePubMedGoogle Scholar
  8. Kato H, Takeuchi O, Mikamo-Satoh E, Hirai R, Kawai T, Matsushita K, Hiiragi A, Dermody TS, Fujita T, Akira S. Length-dependent recognition of double-stranded ribonucleic acids by retinoic acid-inducible gene-I and melanoma differentiation-associated gene 5. J Exp Med. 2008;205:1601–10.View ArticlePubMedPubMed CentralGoogle Scholar
  9. Ablasser A, Bauernfeind F, Hartmann G, Latz E, Fitzgerald KA, Hornung V. RIG-I-dependent sensing of poly(dA:dT) through the induction of an RNA polymerase III-transcribed RNA intermediate. Nat Immunol. 2009;10:1065–72.View ArticlePubMedGoogle Scholar
  10. Chiu YH, Macmillan JB, Chen ZJ. RNA polymerase III detects cytosolic DNA and induces type I interferons through the RIG-I pathway. Cell. 2009;138:576–91.View ArticlePubMedPubMed CentralGoogle Scholar
  11. Melchjorsen J, Rintahaka J, Soby S, Horan KA, Poltajainen A, Ostergaard L, Paludan SR, Matikainen S. Early innate recognition of herpes simplex virus in human primary macrophages is mediated via the MDA5/MAVS-dependent and MDA5/MAVS/RNA polymerase III-independent pathways. J Virol. 2010;84:11350–8.View ArticlePubMedPubMed CentralGoogle Scholar
  12. Sarkar SN, Sen GC. Novel functions of proteins encoded by viral stress-inducible genes. Pharmacol Ther. 2004;103:245–59.View ArticlePubMedGoogle Scholar
  13. Takeuchi O, Akira S. Innate immunity to virus infection. Immunol Rev. 2009;227:75–86.View ArticlePubMedGoogle Scholar
  14. Dixit E, Boulant S, Zhang Y, Lee AS, Odendall C, Shum B, Hacohen N, Chen ZJ, Whelan SP, Fransen M, et al. Peroxisomes are signaling platforms for antiviral innate immunity. Cell. 2010;141:668–81.View ArticlePubMedPubMed CentralGoogle Scholar
  15. Horner SM, Liu HM, Park HS, Briley J, Gale Jr M. Mitochondrial-associated endoplasmic reticulum membranes (MAM) form innate immune synapses and are targeted by hepatitis C virus. Proc Natl Acad Sci U S A. 2011;108:14590–5.View ArticlePubMedPubMed CentralGoogle Scholar
  16. Seth RB, Sun L, Ea CK, Chen ZJ. Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3. Cell. 2005;122:669–82.View ArticlePubMedGoogle Scholar
  17. Lodhi IJ, Semenkovich CF. Peroxisomes: a nexus for lipid metabolism and cellular signaling. Cell Metab. 2014;19:380–92.View ArticlePubMedPubMed CentralGoogle Scholar
  18. Dansen TB, Wirtz KW. The peroxisome in oxidative stress. IUBMB Life. 2001;51:223–30.View ArticlePubMedGoogle Scholar
  19. Mannaerts GP, Van Veldhoven PP. Metabolic pathways in mammalian peroxisomes. Biochimie. 1993;75:147–58.View ArticlePubMedGoogle Scholar
  20. Odendall C, Dixit E, Stavru F, Bierne H, Franz KM, Durbin AF, Boulant S, Gehrke L, Cossart P, Kagan JC. Diverse intracellular pathogens activate type III interferon expression from peroxisomes. Nat Immunol. 2014;15:717–26.View ArticlePubMedPubMed CentralGoogle Scholar
  21. Lam Q, Smibert CA, Koop KE, Lavery C, Capone JP, Weinheimer SP, Smiley JR. Herpes simplex virus VP16 rescues viral mRNA from destruction by the virion host shutoff function. EMBO J. 1996;15:2575–81.PubMedPubMed CentralGoogle Scholar
  22. Mossman KL, Sherburne R, Lavery C, Duncan J, Smiley JR. Evidence that herpes simplex virus VP16 is required for viral egress downstream of the initial envelopment event. J Virol. 2000;74:6287–99.View ArticlePubMedPubMed CentralGoogle Scholar
  23. Smibert CA, Popova B, Xiao P, Capone JP, Smiley JR. Herpes simplex virus VP16 forms a complex with the virion host shutoff protein vhs. J Virol. 1994;68:2339–46.PubMedPubMed CentralGoogle Scholar
  24. Wang QY, Zhou C, Johnson KE, Colgrove RC, Coen DM, Knipe DM. Herpesviral latency-associated transcript gene promotes assembly of heterochromatin on viral lytic-gene promoters in latent infection. Proc Natl Acad Sci U S A. 2005;102:16055–9.View ArticlePubMedPubMed CentralGoogle Scholar
  25. Xing J, Ni L, Wang S, Wang K, Lin R, Zheng C. Herpes simplex virus 1-encoded tegument protein VP16 abrogates the production of beta interferon (IFN) by inhibiting NF-kappaB activation and blocking IFN regulatory factor 3 to recruit its coactivator CBP. J Virol. 2013;87:9788–801.View ArticlePubMedPubMed CentralGoogle Scholar
  26. Carlton-Smith C, Elliott RM. Viperin, MTAP44, and protein kinase R contribute to the interferon-induced inhibition of Bunyamwera Orthobunyavirus replication. J Virol. 2012;86:11548–57.View ArticlePubMedPubMed CentralGoogle Scholar
  27. Chin KC, Cresswell P. Viperin (cig5), an IFN-inducible antiviral protein directly induced by human cytomegalovirus. Proc Natl Acad Sci U S A. 2001;98:15125–30.View ArticlePubMedPubMed CentralGoogle Scholar
  28. Fredericksen BL, Smith M, Katze MG, Shi PY, Gale Jr M. The host response to West Nile Virus infection limits viral spread through the activation of the interferon regulatory factor 3 pathway. J Virol. 2004;78:7737–47.View ArticlePubMedPubMed CentralGoogle Scholar
  29. Helbig KJ, Carr JM, Calvert JK, Wati S, Clarke JN, Eyre NS, Narayana SK, Fiches GN, McCartney EM, Beard MR. Viperin is induced following dengue virus type-2 (DENV-2) infection and has anti-viral actions requiring the C-terminal end of viperin. PLoS Negl Trop Dis. 2013;7:e2178.View ArticlePubMedPubMed CentralGoogle Scholar
  30. Helbig KJ, Eyre NS, Yip E, Narayana S, Li K, Fiches G, McCartney EM, Jangra RK, Lemon SM, Beard MR. The antiviral protein viperin inhibits hepatitis C virus replication via interaction with nonstructural protein 5A. Hepatology. 2011;54:1506–17.View ArticlePubMedPubMed CentralGoogle Scholar
  31. McGillivary G, Jordan ZB, Peeples ME, Bakaletz LO. Replication of respiratory syncytial virus is inhibited by the host defense molecule viperin. J Innate Immun. 2013;5:60–71.View ArticlePubMedGoogle Scholar
  32. Nasr N, Maddocks S, Turville SG, Harman AN, Woolger N, Helbig KJ, Wilkinson J, Bye CR, Wright TK, Rambukwelle D, et al. HIV-1 infection of human macrophages directly induces viperin which inhibits viral production. Blood. 2012;120:778–88.View ArticlePubMedGoogle Scholar
  33. Severa M, Coccia EM, Fitzgerald KA. Toll-like receptor-dependent and -independent viperin gene expression and counter-regulation by PRDI-binding factor-1/BLIMP1. J Biol Chem. 2006;281:26188–95.View ArticlePubMedGoogle Scholar
  34. Szretter KJ, Brien JD, Thackray LB, Virgin HW, Cresswell P, Diamond MS. The interferon-inducible gene viperin restricts West Nile virus pathogenesis. J Virol. 2011;85:11557–66.View ArticlePubMedPubMed CentralGoogle Scholar
  35. Tan KS, Olfat F, Phoon MC, Hsu JP, Howe JL, Seet JE, Chin KC, Chow VT. In vivo and in vitro studies on the antiviral activities of viperin against influenza H1N1 virus infection. J Gen Virol. 2012;93:1269–77.View ArticlePubMedGoogle Scholar
  36. Teng TS, Foo SS, Simamarta D, Lum FM, Teo TH, Lulla A, Yeo NK, Koh EG, Chow A, Leo YS, et al. Viperin restricts chikungunya virus replication and pathology. J Clin Invest. 2012;122:4447–60.View ArticlePubMedPubMed CentralGoogle Scholar
  37. Wang X, Hinson ER, Cresswell P. The interferon-inducible protein viperin inhibits influenza virus release by perturbing lipid rafts. Cell Host Microbe. 2007;2:96–105.View ArticlePubMedGoogle Scholar
  38. Xing J, Wang S, Lin R, Mossman KL, Zheng C. Herpes simplex virus 1 tegument protein US11 downmodulates the RLR signaling pathway via direct interaction with RIG-I and MDA-5. J Virol. 2012;86:3528–40.View ArticlePubMedPubMed CentralGoogle Scholar
  39. Wang K, Ni L, Wang S, Zheng C. Herpes simplex virus 1 protein kinase US3 hyperphosphorylates p65/RelA and dampens NF-kappaB activation. J Virol. 2014;88:7941–51.View ArticlePubMedPubMed CentralGoogle Scholar
  40. Wang S, Wang K, Li J, Zheng C. Herpes simplex virus 1 ubiquitin-specific protease UL36 inhibits beta interferon production by deubiquitinating TRAF3. J Virol. 2013;87:11851–60.View ArticlePubMedPubMed CentralGoogle Scholar
  41. Wang S, Wang K, Lin R, Zheng C. Herpes simplex virus 1 serine/threonine kinase US3 hyperphosphorylates IRF3 and inhibits beta interferon production. J Virol. 2013;87:12814–27.View ArticlePubMedPubMed CentralGoogle Scholar
  42. Zhang J, Wang K, Wang S, Zheng C. Herpes simplex virus 1 E3 ubiquitin ligase ICP0 protein inhibits tumor necrosis factor alpha-induced NF-kappaB activation by interacting with p65/RelA and p50/NF-kappaB1. J Virol. 2013;87:12935–48.View ArticlePubMedPubMed CentralGoogle Scholar
  43. Zhang J, Wang S, Wang K, Zheng C. Herpes simplex virus 1 DNA polymerase processivity factor UL42 inhibits TNF-alpha-induced NF-kappaB activation by interacting with p65/RelA and p50/NF-kappaB1. Med Microbiol Immunol. 2013;202:313–25.View ArticlePubMedGoogle Scholar
  44. Zhu H, Zheng C, Xing J, Wang S, Li S, Lin R, Mossman KL. Varicella-zoster virus immediate-early protein ORF61 abrogates the IRF3-mediated innate immune response through degradation of activated IRF3. J Virol. 2011;85:11079–89.View ArticlePubMedPubMed CentralGoogle Scholar
  45. Xing J, Wang S, Li Y, Guo H, Zhao L, Pan W, Lin F, Zhu H, Wang L, Li M, Zheng C. Characterization of the subcellular localization of herpes simplex virus type 1 proteins in living cells. Med Microbiol Immunol. 2011;200:61–8.View ArticlePubMedGoogle Scholar
  46. Su C, Zhan G, Zheng C. Evasion of host antiviral innate immunity by HSV-1, an update. Virol J. 2016;13:38.View ArticlePubMedPubMed CentralGoogle Scholar
  47. Zenner HL, Mauricio R, Banting G, Crump CM. Herpes simplex virus 1 counteracts tetherin restriction via its virion host shutoff activity. J Virol. 2013;87:13115–23.View ArticlePubMedPubMed CentralGoogle Scholar
  48. Shen G, Wang K, Wang S, Cai M, Li ML, Zheng C. Herpes simplex virus 1 counteracts viperin via its virion host shutoff protein UL41. J Virol. \2014;88:12163–6.View ArticlePubMedPubMed CentralGoogle Scholar
  49. Su C, Zhang J, Zheng C. Herpes simplex virus 1 UL41 protein abrogates the antiviral activity of hZAP by degrading its mRNA. Virol J. 2015;12:203.View ArticlePubMedPubMed CentralGoogle Scholar
  50. Verpooten D, Ma Y, Hou S, Yan Z, He B. Control of TANK-binding kinase 1-mediated signaling by the gamma(1)34.5 protein of herpes simplex virus 1. J Biol Chem. 2009;284:1097–105.View ArticlePubMedPubMed CentralGoogle Scholar
  51. Zhang D, Su C, Zheng C. Herpes simplex virus 1 serine protease VP24 blocks the DNA-sensing signal pathway by abrogating activation of interferon regulatory factor 3. J Virol. 2016;90:5824–9.View ArticlePubMedPubMed CentralGoogle Scholar
  52. Xing J, Wang S, Lin F, Pan W, Hu CD, Zheng C. Comprehensive characterization of interaction complexes of herpes simplex virus type 1 ICP22, UL3, UL4, and UL20.5. J Virol. 2011;85:1881–6.View ArticlePubMedGoogle Scholar
  53. Jordan M, Schallhorn A, Wurm FM. Transfecting mammalian cells: optimization of critical parameters affecting calcium-phosphate precipitate formation. Nucleic Acids Res. 1996;24:596–601.View ArticlePubMedPubMed CentralGoogle Scholar


© The Author(s). 2017
