Open Access

Detection and phylogenetic analysis of porcine epidemic diarrhea virus in central China based on the ORF3 gene and the S1 gene

  • Yunfang Su1,
  • Yunchao Liu2Email author,
  • Yumei Chen2,
  • Baolei Zhao3,
  • Pengchao Ji1,
  • Guangxu Xing2,
  • Dawei Jiang3,
  • Chang Liu2,
  • Yapeng Song3,
  • Guoqiang Wang3,
  • Dongliang Li3,
  • Ruiguang Deng2 and
  • Gaiping Zhang2, 3, 4Email author
Virology Journal201613:192

https://doi.org/10.1186/s12985-016-0646-8

Received: 28 June 2016

Accepted: 10 November 2016

Published: 25 November 2016

Abstract

Background

Porcine epidemic diarrhea (PED) has increased in severity in China since 2010. To investigate further the infectivity, genetic diversity and molecular epidemiology of its causative agent, the porcine epidemic diarrhea virus (PEDV), we assessed 129 clinical samples, which were the intestinal tissue of piglets with severe diarrhea, from 17 cities in central China. Both the spike (S) glycoprotein (S1, 1–789 amino acids (aa)) and the full-length ORF3 gene of 21 representative field strains from 21 farms in 11 cities were sequenced and analysed.

Methods

PEDV was detected by reverse transcription-polymerase chain reaction (RT-PCR), and S1 and ORF3 sequences were processed by the Clustal W method via DNAMAN 8 software, and phylogenetic trees were constructed by the neighbor-joining method using MEGA 6 software.

Results

The prevalence of PEDV was 92.25% and was detected in 119 of 129 samples, with 94.03% (63 of 67) of pig farms harbouring the disease. According to the phylogenetic analysis of the S1 genes, our isolates all fell into group G2 (variants) and showed a close relationship to isolates from Chinese (HN1303, CH/ZMDZY/11 and AJ1102), Korean (AD01), American (MN, IA1, IA2 and 13–019349) sources, and these isolates differed genetically from other Chinese (LZC, CH/HNZZ/2011 and SD-M) and Korean (SM98) strains as well Japanese (83-P5 and MK) strains. In addition, our isolates differed from attenuated vaccine strains, CV777 (used in China) and DR13 (used in Korea). According to our derived amino acid sequence analysis, we detected one novel variant PEDV, viz: CH/HNLY, with 4-aa insertion/deletion (RSSS/T) at position 375 and 1-aa (D) deletion at position 430 compared to the CV777 attenuated strain. These mutations were located on the receptor binding domain. Our ORF3 gene analyses showed that the prevalent PEDV isolates were variants, and the isolated strains differed genetically from the vaccine strains.

Conclusions

These findings illustrated the existence of genetic diversity among geographically distinct PEDV strains, and our study has provided an impetus to conduct further research on the PEDV receptor binding protein and on the new and efficacious vaccines design.

Keywords

PEDV ORF3 gene S1 gene Phylogenetic analysis Variants

Background

Porcine epidemic diarrhoea (PED) is an acute, highly contagious disease of swine caused by the PED virus (PEDV), which leads to severe vomiting and diarrhea along with dehydration and high mortality in new-born piglets [1]. PEDV belongs to the family Coronaviridae, genus Alphacoronavirus and was first reported in England [2]. PEDV has now been reported worldwide, including in Belgium, France, Japan, Korea, Italy, Thailand, USA, Canada and Mexico [15] and poses severe economic burdens. Since 2010 serious PED has been detected in China [6]. PEDV is an enveloped ssRNA coronavirus with a 28 kb genome, including seven open reading frames (ORFs), a 5′ untranslated region (UTR), and a 3′ UTR with a polyadenylated tail. The seven ORFs encode four structural proteins, spike (S), envelope (E), membrane (M) and nucleocapsid (N) and three non-structural proteins, replicases 1a, 1b and ORF3 [7, 8]. The S protein contains a specific receptor binding site that is important for cell membrane fusion and virus entry and is an antigenic target for neutralising antibodies [9]. The M protein is the most abundant surface protein, and coexpression with E protein to form pseudo-particles results in interfering genic activity [10]. The N protein is highly conserved and binds to virion RNA to provide a structural basis for the helical nucleocapsid, and it is used for early diagnosis [11]. For non-structural proteins, replicases 1a and 1b are multi-functional and associated with viral genome replication [12], and the accessory ORF3 protein is thought to influence virulence [13].

The S1 domain (amino acids (aa) 21–793) contains two subdomains: NTD (aa 21–324) and CTD (aa 253–638) [14], with the latter binding to porcine aminopeptidase N (pAPN) which is important for cell membrane fusion and virus entry and it is the antigenic target of neutralising antibodies [15]. Thus, the variable S1 gene has been widely used for studies of PEDV genetic evolution and diversity [16, 17]. PEDV CV777 has three main neutralising epitopes: aa 498–637 (CO-26 K equivalent, COE gene) [18], aa 747–754 (YSNIGVCK) and aa 763–770 (LQDGQVKI) [19]. Sequence analyses indicated that the latest PEDV isolated strains in China were different from attenuated CV777 [16, 20, 21]. Multiple mutations of the S protein resulted in two PEDV genotypes, G1 and G2 (classical strains and variant strains) [16], and a recent study suggested that antigenic variation exists between G1 and G2 [22]. The variable S1 gene has been widely used for studies of PEDV genetic evolution and diversity [16, 17]. The accessory ORF3 gene is highly relevant to the virulence of PEDV as previously stated [13], and reduction in virulence is produced through cell culture adaptation [23, 24]. The ORF3 gene of attenuated vaccine isolates has a continuous deletion of 17 amino acids (aa 82–99), thus distinguishing the vaccine isolates from variant PEDV [24]. Therefore, the ORF3 gene has been the focus of molecular epidemiology PEDV studies [16, 20, 21, 25]. As aforementioned, we chose the S1 and ORF3 genes as the target genes for phylogenetic analysis.

Phylogenetic analysis of variations in the S1 gene of isolates collected in China distinguished the PEDV genotypes G1 and G2, including 1a classical PEDV, 1b classical PEDV, 2a circulating PEDV and 2b circulating PEDV subgroups [26]. Based on the ORF3 gene, the phylogenetic analysis of PEDV isolates in China manifested in genotypes G1 and G2, the G2 genotype including 2a PEDV and 2b PEDV subgroups [27]. To investigate further infectivity, genetic diversity and molecular epidemiology of PEDV, we performed phylogenetic analyses based on the S1 and ORF3 genes of the latest Chinese isolates collected. In this study, 129 samples were obtained from 67 farms in 17 cities of central China, and the S1 and ORF3 genes of 21 representative field strains from 21 farms in 11 cities were sequenced and analysed.

Methods

Sample collection and cDNA synthesis

In this study, 129 intestinal tissue samples from new-born piglets suffering from severe diarrhea were collected from 67 farms in 17 cities (Zhengzhou, Kaifeng, Anyang, Hebi, Puyang, Xinxiang, Luoyang, Nanyang, Pingdingshan, Sanmenxia, Luohe, Jiaozuo, Xuchang, Yuncheng, Zhoukou, Zhumadia, and Xinyang) of central China from July 2014 to July 2015. Samples were diluted with 5 volumes of 0.9% saline (w/v), frozen and thawed three times and then clarified by centrifugation for 5 min at 3000 rpm. Three hundred microliters of the supernatants were used for RNA extraction using TRIzol, dissolved in RNase-free water and then stored at −80 °C until further use. Synthesis of the cDNA was carried out through reverse transcription as described below. A total of 13 μl of viral RNA (approximately 1 μg) was mixed with 1 μl of 10 pmol Oligo (dT) primer (TaKaRa), incubated at 70 °C for 10 min, then placed on ice for 1 min. Next, 4 μl of 5× RT buffer, 1 μl of dNTP (2.5 mM) mixture, 0.5 μl of RNase inhibitor (40 U/μl) and 0.5 μl of reverse transcriptase M-MLV (200 U/μl) were added and gently mixed. The mixture was kept at 42 °C for 1 h and the resulting cDNA stored at −20 °C until further use.

Clinical samples detection

Primers used in this study were designed to target the conserved regions of the S gene and were synthesised by Sangon Biotech. The primers are listed in Table 1. For the PCR reactions, 1 μl of cDNA, 10 μl ExTaq DNA polymerase (TAKARA), 1 μl of each primer (10 pmol) and RNase-free water in a total volume of 20 μl. The amplification was carried out as follows: 95 °C for 5 min, followed by 33 cycles of 95 °C for 1 min, 57 °C for 1 min and 72 °C for 1 min and finally 72 °C for 10 min. The products were examined by electrophoresis using a 1.0% agarose gel.
Table 1

Primers used in this study

Primer name

Nucleotide sequence, 5′-3′

Size(bp)

Primer locationa

PEDV-F

TTTATTCTGTCACGCCAT

197

2,2709–22,726

PEDV-R

AGATTTACAAACACCTATGTTA

 

22,884–22,905

S1U1-F

GGTAAGTTGCTAGTGCGTAA

1461

20,570–20,589

S1U1-R

CAGGATCATCACAATAAAGAA

22,010–22,030

S1U2-F

TTTCTGGACCATAGCATC

1117

21,939–21,956

S1U2-R

AGCACAATCAACACTAAC

23,038–23,055

ORF3-F

TCCTAGACTTCAACCTTACG

833

24,741–24,760

ORF3-R

GGTGACAAGTGAAGCACAGA

25,551–25,570

aIn relation to the genome of PEDV CV777 strain (AF353511)

Sequencing of the S1 and ORF3 genes

The S1 and ORF3 genes of 21 representative field strains from 21 farms in 11 cities (Kaifeng, Anyang, Hebi, Puyang, Xinxiang, Luoyang, Nanyang, Sanmenxia, Xuchang, Yuncheng and Zhumadian) were amplified by PCR. To obtain the complete S1 (1–789 aa) sequence, four primers (S1U1F, S1U1R, S1U2F and S1U2R) were designed and synthesised as previously described [2830] according to Table 1, and the length of the final fragment was 2367 bp. The full-length ORF3 gene was obtained using previously published primers, and the length of the PCR product was 833 bp [31]. PCR products were purified, subcloned into pMD19-T and transformed using DH5α competent cells. The reagents were purchased from TaKaRa. Triplicate recombinant DNA positive clones from each PEDV isolate were sequenced by Sangon Biotech, China.

Multiple sequence alignments and phylogenetic analysis

The complete S1 gene (2367 bp) was obtained through the sequence matching of S1U1 and S1U2 with flanking sequences removed. Sequences of S1 and ORF3 were processed by the Clustal W method through the DNAMAN 8 software, and phylogenetic trees were constructed by the neighbor-joining method using MEGA 6 software. Bootstrap values were indicated for each node from 1000 replicates. In addition, 37 reference strains (Table 2) were chosen from Genbank for inclusion in the phylogenetic analysis.
Table 2

Reference strains used in this study

Reference strains

Countries

S gene(nt)

ORF3 gene(nt)

Accession no.

CV777

Belgium,1978

2367

675

AF353511.1

CV777 attenuated

China, 1998

2364

276

KT323979.1

DR13/virulent

Korea,1999

2367

675

JQ023161.1

CH/ZMDZY/11

China,2011

2376

675

KC196276.1

LZC

China/Gansu,<2006

2367

675

EF185992.1

SM98

Korea,1998

2379

675

GU937797.1

MN

USA,2013

2376

675

KF468752.1

IA1

USA,2013

2376

675

KF468753.1

IA2

USA,2013

2376

675

KF468754.1

DR13/attenuated

Korea,2003

2364

276

JQ023162

SD-M

China/Shandong,2012

2364

276

JX560761

GD-A

China/Guangdong,2012

2376

675

JX112709

CH/S

China/Shanghai,1986

2367

675

JN547228

TC PC177-P2

USA,2013

1785

675

KM392229

BJ-2011-1

China/Beijing,2011

2376

675

JN825712

AH2012

China/Anhui,2012

2376

675

KC210145

AJ1102

China/Hubei,2011

2376

675

JX188454

83P-5

Japan1983

2364

AB548621

CH/JX-1/2013

China/Jiangxi,2013

2376

675

KF760557

CH/JX-2/2013

China/Jiangxi,2013

2376

675

KJ526096

Brl/87

France, 1987

2367

Z25483

HN1303

China/Luoyang,2013

2376

KR080551

CH/FCH-01

China,2013

675

KF476054(O)

CH/JCH

China,2013

675

KF476059(O)

CH/KF-01

China,2013

675

KF476051(O)

CH/XIP-03

China,2013

675

KF476058(O)

13-019349

USA,2013

2376

675

KF267450.1

Chinju99

Korea,2009

675

EU792474.1(O)

CH/HLJHH-2/2011

China,2012

675

JQ305099.1(O)

MK

Japan,2013

2367

675

AB548624.1(cS)

AD01

Korea,2013

2376

KC879280.1(cS)

CH/HNZZ/2011

China,2011

2364

JN601050(S1)

CH/FJXM-1/2012

China,2012

2376

JX070671

MYG-1/JPN/2014

Japan,2014

1794

LC063838.1

TTR-2/JPN/2014

Japan,2014

252

LC063828.1

OH851

USA,2014

2367

675

KJ399978.1

SH/2015/124

China,2015

2376

675

KU710245.1(S1), KU641672.1(ORF3)

Results

PEDV detection

PEDV were detected by PCR on 94.03% (63 of 67) pig farms in 17 cities, and 92.25% (119 of 129) of samples were positive for PEDV in clinical diseased samples.

Phylogenetic analysis of the S1 gene

According to the phylogenetic analysis of the S1 gene, 21 PEDV isolates in this study (Table 3) were all subtype G2 and were distributed in two subgroups: 2a circulating PEDV and 2b circulating PEDV (Fig. 1a). Our isolates showed a close relationship to some isolates from China (CH/ZMDZY/11, HN1303, AJ1102, et al.), Korea (AD01) and American (MN, IA1, IA2, 13–019349); however, our isolates differed from isolates collected previously from China (LZC, CH/HNZZ/2011, and SD-M), Korea (SM98), Japan (83-P5 and MK) and the vaccine strain CV777-attenuated (used in China) and DR13 (used in Korea) which showed similar to the phylogenetic trees based on the sequences of amino acid (see Additional file 1: Figure S1). According to the sequences of S1 genes processed by DNAMAN 8 software, our isolates exhibited 92.1–92.7% nucleotide identity and 89.7–91.2% amino acid identity compared with the CV777 strain. Meanwhile, our isolates exhibited 91.4–92.0% nucleotide identity and 89.1–90.7% amino acid identity compared with the CV777 attenuated strain.
Table 3

The PEDV field strains used in this study

Field strains

Origin

S gene(nt)

Accession no.

ORF3 gene(nt)

Accession no.

CH/HNHB-1

Hebi, Henan

2376

KU977480

675

KU977501

CH/HNHB-2

Hebi, Henan

2376

KU977481

675

KU977502

CH/HNHB-3

Hebi, Henan

2376

KU977482

675

KU977503

CH/HNHB-4

Hebi, Henan

2376

KU977483

675

KU977504

CH/HNHB-5

Hebi, Henan

2376

KU977484

675

KU977505

CH/HNHB-6

Hebi, Henan

2376

KU977485

675

KU977506

CH/HNHB-7

Hebi, Henan

2376

KU977486

675

KU977507

CH/HNKF-1

Kaifeng, Henan

2376

KU977487

675

KU977508

CH/HNKF-2

Kaifeng, Henan

2376

KU977488

675

KU977509

CH/HNKF-3

Kaifeng, Henan

2376

KU977489

675

KU977510

CH/HNSMX

Sanmenxia, Henan

2376

KU977490

675

KU977511

CH/SXYC

Yuncheng, Shanxi

2376

KU977491

675

KU977512

CH/HNXC

Xuchang, Henan

2376

KU977492

675

KU977513

CH/HNXX

Xinxiang, Henan

2376

KU977493

675

KU977514

CH/HNAY

Anyang, Henan

2376

KU977494

675

KU977515

CH/HNNY-1

Nanyang, Henan

2376

KU977495

675

KU977516

CH/HNNY-2

Nanyang, Henan

2376

KU977496

675

KU977517

CH/HNNY-3

Nanyang, Henan

2376

KU977497

675

KU977518

CH/HNZMD

Zhumadian, Henan

2376

KU977498

675

KU977519

CH/HNLY

Luoyang, Henan

2382

KU977499

675

KU977520

CH/HNPY

Puyang, Henan

2376

KU977500

675

KU977521

Fig. 1

a Phylogenetic analysis of the S1 nucleotide sequences of 21 PEDV isolates, including the reference strains. b Phylogenetic analysis of the ORF3 nucleotide sequences of 21 PEDV isolates, including the reference strains. The trees were constructed by the neighbor-joining method in MEGA 6 software. Bootstrap values were indicated for each node from 1000 replicates. The names of the strains, years and places of isolation and GenBank accession numbers proposed are shown in Tables 2 and 3. ‘’ indicates the strains in this study

According to the predicted amino acid sequence of S1 genes in this study, we found one novel PEDV variant, CH/HNLY, that had 4-aa substitution at position 375, RSSS375T and a single deletion at position 430 (Fig. 2). Correspondingly, at the nucleotide level, CH/HNLY had 9-nt (GGTCGTCGT) insertion between positions 1123 (A) and 1124 (T) and 3-nt (GAT) deletion between positions 1283 (C) and 1287 (G).
Fig. 2

CV777/attenuated as the reference strain and the amino acid sequence of CH/HNLY, with 4-aa insertion/deletion (RSSS/T) at position 375 and 1-aa (D) deletion at position 430 (CV777 attenuated strain accession number: KT323979.1) are indicated

We also examined the three major epitope regions, viz : aa 498–637, aa 747–754 and aa 763–770. The sequences at aa 747–754 were conserved between the latest Chinese PEDV isolates and CV777 attenuated strain, however the sequences at positions 498–637 and 763–770 were variable (Table 4).
Table 4

Analysis of amino acid mutations in epitopes domains of field strains and the CV777 attenuated vaccine strain (aa 498–637, aa 747–754 and aa 763–770 located in CV777 attenuated)

Strains

499

500

514

516

520

522

526

530

543

548

561

572

583

587

590

593

604

607

608

611

632

634

636

751

762

763

765

766

768

CV777 attenuated

T

L

S

A

H

G

I

T

R

T

S

K

K

S

L

G

E

S

G

F

Q

V

D

G

P

L

D

G

V

CV777

    

L

S

V

         

A

  

L

E

I

   

S

Y

  

CH/ZMDZY/11

   

S

R

 

T

  

S

  

N

  

S

    

E

    

S

S

  

CH/HNHB-1

D

  

S

     

S

     

S

    

E

    

S

S

  

CH/HNHB-2, CH/HNHB-5

  

A

S

     

S

     

S

D

 

S

 

E

    

S

S

  

CH/HNHB-3

 

P

 

S

     

S

     

S

    

E

    

S

S

D

 

CH/HNHB-4

A

  

S

     

S

 

N

   

S

    

E

    

S

S

  

CH/HNHB-6, CH/HNHB-7

  

A

S

     

S

     

S

D

   

E

    

S

S

  

CH/HNKF-1, CH/HNLY

   

S

     

S

     

S

    

E

    

S

S

  

CH/HNKF-2

   

S

     

S

Y

    

S

    

E

    

S

S

  

CH/HNKF-3

   

S

     

S

Y

   

P

S

    

E

    

S

S

  

CH/HNSMX

         

S

   

T

 

S

    

E

 

G

  

S

S

  

CH/SXYC

   

S

   

A

 

S

     

S

    

E

    

S

S

  

CH/HNXC

   

S

     

S

     

S

    

V

    

S

S

  

CH/HNXX

   

S

     

S

     

S

  

V

 

E

    

S

S

  

CH/HNAY

A

  

S

Y

    

S

     

S

    

E

   

L

S

S

  

CH/HNNY-1, CH/HNNY-2, CH/HNNY-3,

   

S

Y

    

S

     

S

    

E

    

S

S

  

CH/HNZMD

   

S

     

S

 

H

   

S

  

V

 

E

    

S

S

 

A

CH/HNPY

A

  

S

Y

    

S

     

S

    

E

   

L

S

S

  

Phylogenetic analysis of the ORF3 gene

According to the analysis of the ORF3 genes, 21 PEDV isolates in this study (Table 3) were all subtype G2 and were distributed in subgroup G2b which showed similar to the phylogenetic trees based on the sequences of amino acid (see Additional file 2: Figure S2); in addition, our strains showed a close relationship to published isolates and genetically differed from the vaccine strains which were all subtype G1 (Fig. 1b), indicating that the prevailing PEDV strains were mostly variants. According to the sequences of ORF3 genes processed by DNAMAN 8 software, our isolates exhibited 95.9–96.9% nucleotide identity and 93.8–96.4% amino acid identity compared with the CV777 strain. Meanwhile, our isolates exhibited 91.3–93.1% nucleotide identity and 84.6–89% amino acid identity compared with the CV777 attenuated strain.

Discussion

Previous studies found that 79.66% of pig farms in 29 provinces to be positive for the presence of PEDV, with 72.27% of samples confirmed as PEDV-positive [16]. In the present study, 94.03% (63 of 67) of pig farms in 17 cities, 92.25% (119 of 129) samples, were PEDV-positive, indicating a high prevalence of PEDV in clinical diseased samples.

The S gene might correlate with PEDV pathogenicity [4]. The S1 domain of the S protein is the major target for PEDV vaccine development [32]. Our previous report suggested that the amino acid changes in the S1 domain might be associated with a change in antigenicity [20]. Extensive variation of the S protein has been reported earlier [17, 33]. In this study, we found that in the three major epitope regions, the amino acid sequence at aa 748–755 was conserved, whereas aa 499–638 and aa 764–771 were variable. Accordingly, within the S1 domain of the S protein, the series of single amino acid substitutions found were: S516A, S548T, S593G, E632Q, S763L and S765D. These changes were found in the strain CH/ZMDZY/11 that was previously isolated in central China [34]. However, as shown in Table 4, there were other single aa mutations, suggesting that the gene encoding the antigenic domain of S1 may constantly vary. According to the phylogenetic analysis, our isolates were all subtype G2 (Fig. 1a) and mostly further divided into two subgroups, 2a circulating PEDV and 2b circulating PEDV. We have shown that the S1 domain of isolates differed genetically from the classical PEDV, but the isolates were similar to previously reported isolates from eastern, north western and southern China [3537], which might be the reason why the currently existing vaccine is inefficient.

In this study, we detected one novel PEDV variant, CH/HNLY, with mutations at positions 375 and 430 (RSSS375T and deletion at aa 430D), which are located on the receptor binding domain (aa 253–638) for pAPN [15, 38]. The phylogenetic analysis of nucleotide variation demonstrated that CH/HNLY was related to 2b circulating PEDV. It was reported that the classical PEDV exhibited weaker sugar-binding activity compared with the field isolate variant [39]. Reports have also found amino acid substitutions in the receptor-binding region [27]. Whether or not these changes affect the biological functions of PEDV will require further investigation.

The ORF3 gene is highly relevant to the virulence of PEDV [23, 40], since it regulates virus production [13]. The ORF3 genes of the PEDV isolates in this study and other isolates did not show the large deletion characteristic of the vaccine CV777 strain. According to the phylogenetic analysis of ORF3, the 21 PEDV isolates in this study were divided into subtype G2 (Fig. 1b). The ORF3 gene analysis not only suggested that the isolates in central China were not only vaccine-unrelated, but the presence of multiple, distinct mutations indicated there is widespread diversity in this virulence gene. However, further studies are needed to clarify whether the virulence is change among these PEDV strains.

Phylogenetic analysis of both the S1 and ORF3 genes showed that our isolates exhibited high similarity to variant reference strains and differed from CV777. Phylogenetic analysis of ORF3 did not reveal differences between our isolates and partial classical PEDV strains which was similar to other report [27]. Further studies are required to clarify the biological functions among PEDV phylogenetic groups.

Conclusions

In conclusion, our study highlighted the present landscape of PEDV in central China, and the isolated strains in this study were all variable and genetically diverse. These findings make it clear that a new vaccine is required to control this disease. In addition, the discovery of a novel strain, CH/HNLY, provides an avenue for future investigations into the biological functions of PEDV.

Declarations

Acknowledgments

The authors would like to thank professor Gregson, London University, for revising the paper and thank Guangxu Xing, for processing data and revising the manuscript.

Funding

The work was supported by grants from National Key R&D Program (2016YFD0500704), Major Program of Science and Technology in Henan (No.141100110100) and Program of Henan finance (No.201678-24).

Authors’ contributions

YSu, YL, and YC designed experiments; YSu, BZ, PJ, DJ, CL, YSong, GW, and DL carried out experiments; YSu, YL and GX analyzed experimental results and analyzed sequencing data; YSu, YL, RD, and GZ wrote the manuscript. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Ethics approval

This work complied with the Ethical Standards of the Committee on Publication Ethics (COPE).

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
College of Veterinary Medicine, Northwest Agriculture and Forestry University
(2)
Henan Provincial Key Laboratory of Animal Immunology, Henan Academy of Agricultural Science
(3)
College of Animal Science and Veterinary Medicine, Henan Agricultural University
(4)
Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses

References

  1. Pensaert MB, de Bouck P. A new coronavirus-like particle associated with diarrhea in swine. Arch Virol. 1978;58:243–7.View ArticlePubMedGoogle Scholar
  2. Takahashi K, Okada K, Ohshima K. An outbreak of swine diarrhea of a new-type associated with coronavirus-like particles in Japan. J Vet Sci. 1983;45:829–32.Google Scholar
  3. Puranaveja S, Poolperm P, Lertwatcharasarakul P, Kesdaengsakonwut S, Boonsoongnern A, Urairong K, et al. Chinese-like strain of porcine epidemic diarrhea virus, Thailand. Emerg Infect Dis. 2009;15:1112–5.View ArticlePubMedPubMed CentralGoogle Scholar
  4. Martelli P, Lavazza A, Nigrelli AD, Merialdi G, Alborali LG. Epidemic of diarrhoea caused by porcine epidemic diarrhoea virus in Italy. Vet Rec. 2008;162:307–10.View ArticlePubMedGoogle Scholar
  5. Cima G. Viral disease affects U.S. pigs: porcine epidemic diarrhea found in at least 11 states. J Am Vet Med Assoc. 2013;243:30–1.PubMedGoogle Scholar
  6. Sun RQ, Cai RJ, Chen YQ, Liang PS, Chen DK, Song CX. Outbreak of porcine epidemic diarrhea in suckling piglets, China. Emerg Infect Dis. 2012;18:161–3.View ArticlePubMedPubMed CentralGoogle Scholar
  7. Bridgen A, Kocherhans R, Tobler K, Carvajal A, Ackermann M. Further analysis of the genome of porcine epidemic diarrhoea virus. Adv Exp Med Biol. 1998;440:781–6.View ArticlePubMedGoogle Scholar
  8. Kocherhans R, Bridgen A, Ackermann M, Tobler K. Completion of the Porcine Epidemic Diarrhoea Coronavirus (PEDV) genome sequence. Virus Genes. 2001;23:137–44.View ArticlePubMedGoogle Scholar
  9. Duarte M, Tobler K, Bridgen A, Rasschaert D, Ackermann M, Laude H. Sequence analysis of the porcine epidemic diarrhea virus genome between the nucleocapsid and spike protein genes reveals a polymorphic ORF. Virology. 1994;198:466–76.View ArticlePubMedGoogle Scholar
  10. Baudoux P, Carrat C, Besnardeau L, Charley B, Laude H. Coronavirus pseudoparticles formed with recombinant M and E proteins induce alpha interferon synthesis by leukocytes. J Virol. 1998;72:8636–43.PubMedPubMed CentralGoogle Scholar
  11. Curtis KM, Yount B, Baric RS. Role of nucleotides immediately flanking the transcription-regulating sequence core in coronavirus subgenomic mRNA synthesis. J Virol. 2002;76:1422–34.View ArticlePubMedPubMed CentralGoogle Scholar
  12. Brian DA, Baric RS. Coronavirus genome structure and replication. Curr Top Microbiol Immunol. 2005;287:1–30.PubMedGoogle Scholar
  13. Wang K, Lu W, Chen J, Xie S, Shi H, Hsu H, et al. PEDV ORF3 encodes an ion channel protein and regulates virus production. FEBS Lett. 2012;586:384–91.View ArticlePubMedGoogle Scholar
  14. Li F. Receptor recognition mechanisms of coronaviruses: a decade of structural studies. J Virol. 2015;89:1954–64.View ArticlePubMedGoogle Scholar
  15. Deng F, Ye G, Liu Q, Navid MT, Zhong X, Li Y, et al. Identification and comparison of receptor binding haracteristics of the spike protein of two porcine pidemic diarrheavirus strains. Viruses. 2016; doi: 10.3390/v8030055.Google Scholar
  16. Chen J, Liu X, Shi D, Shi H, Zhang X, Li C, et al. Detection and molecular diversity of spike gene of porcine epidemic diarrhea virus in China. Viruses. 2013;5:2601–13.View ArticlePubMedPubMed CentralGoogle Scholar
  17. Suzuki T, Murakami S, Takahashi O, Kodera A, Masuda T, Itoh S, et al. Molecular characterization of pig epidemic diarrhoea viruses isolated in Japan from 2013 to 2014. Infect Genet Evol. 2015;36:363–8.View ArticlePubMedGoogle Scholar
  18. Chang SH, Bae JL, Kang TJ, Kim J, Chung GH, Lim CW, et al. Identification of the epitope region capable of inducing neutralizing antibodies against the porcine epidemic diarrhea virus. Mol Cells. 2002;14:295–9.PubMedGoogle Scholar
  19. Sun D, Feng L, Shi H, Chen J, Cui X, Chen H, et al. Identification of two novel B cell epitopes on porcine epidemic diarrhea virus spike protein. Vet Microbiol. 2008;131:73–81.View ArticlePubMedGoogle Scholar
  20. Li R, Qiao S, Yang Y, Su Y, Zhao P, Zhou E, et al. Phylogenetic analysis of porcine epidemic diarrhea virus (PEDV) field strains in central China based on the ORF3 gene and the main neutralization epitopes. Arch Virol. 2013;159:1057–65.View ArticlePubMedGoogle Scholar
  21. Song D, Huang D, Peng Q, Huang T, Chen Y, Zhang T, et al. Molecular characterization and phylogenetic analysis of porcine epidemic diarrhea viruses associated with outbreaks of severe diarrhea in piglets in Jiangxi, China 2013. PLoS One. 2015;10:e0120310.View ArticlePubMedPubMed CentralGoogle Scholar
  22. Wang X, Chen J, Shi D, Shi H, Zhang X, Yuan J, et al. Immunogenicity and antigenic relationships among spike proteins of porcine epidemic diarrhea virus subtypes G1 and G2. Arch Virol. 2016;161:537–47.View ArticlePubMedGoogle Scholar
  23. Park SJ, Song DS, Ha GW, Park BK. Cloning and further sequence analysis of the spike gene of attenuated porcine epidemic diarrhea virus DR13. Virus Genes. 2007;35:55–64.View ArticlePubMedGoogle Scholar
  24. Park SJ, Moon HJ, Luo Y, Kim HK, Kim EM, Yang JS, et al. Cloning and further sequence analysis of the ORF3 gene of wild- and attenuated-type porcine epidemic diarrhea viruses. Virus Genes. 2008;36:95–104.View ArticlePubMedGoogle Scholar
  25. Temeeyasen G, Srijangwad A, Tripipat T, Tipsombatboon P, Piriyapongsa J, Phoolcharoen W, et al. Genetic diversity of ORF3 and spike genes of porcine epidemic diarrhea virus in Thailand. Infect Genet Evol. 2014;21:205–13.View ArticlePubMedGoogle Scholar
  26. Huang YW, Dickerman AW, Piñeyro P, Li L, Fang L, Kiehne R, et al. Origin, evolution, and genotyping of emergent porcine epidemic diarrhea virus strains in the United States. MBio. 2013;4:e00737–13.View ArticlePubMedPubMed CentralGoogle Scholar
  27. Wang E, Guo D, Li C, Wei S, Wang Z, Liu Q, Zhang B, Kong F, Feng L, Sun D. Molecular characterization of the ORF3 and S1 Genes of porcine epidemic diarrhea virus non S-INDEL strains in seven regions of China, 2015. PLoS One. 2016;11:e0160561. doi:10.1371/journal.pone.0160561.View ArticlePubMedPubMed CentralGoogle Scholar
  28. Kim SY, Song DS, Park BK. Differential detection of transmissible gastroenteritis virus and porcine epidemic diarrhea virus by duplex RT-PCR. J Vet Diagn Invest. 2001;13:516–20.View ArticlePubMedGoogle Scholar
  29. Jung K, Chae C. Effect of temperature on the detection of porcine epidemic diarrhea virus and transmissible gastroenteritis virus in fecal samples by reverse transcription-polymerase chain reaction. J Vet Diagn Invest. 2004;16:237–9.View ArticlePubMedGoogle Scholar
  30. Song DS, Kang BK, Oh JS, Ha GW, Yang JS, Moon HJ, et al. Multiplex reverse transcription-PCR for rapid differential detection of porcine epidemic diarrhea virus, transmissible gastroenteritis virus, and porcine group A rotavirus. J Vet Diagn Invest. 2006;18:278–81.View ArticlePubMedGoogle Scholar
  31. Song DS, Yang JS, Oh JS, Han JH, Park BK. Differentiation of a Vero cell adapted porcine epidemic diarrhea virus from Korean field strains by restriction fragment length polymorphism analysis of ORF3. Vaccine. 2003;21:1833–42.View ArticlePubMedGoogle Scholar
  32. Oh J, Lee KW, Choi HW, Lee C. Immunogenicity and protective efficacy of recombinant S1 domain of the porcine epidemic diarrhea virus spike protein. Arch Virol. 2014;159:2977–87.Google Scholar
  33. Oka T, Saif LJ, Marthaler D, Esseili MA, Meulia T, Lin CM, et al. Cell culture isolation and sequence analysis of genetically diverse US porcine epidemic diarrhea virus strains including a novel strain with a large deletion in the spike gene. Vet Microbiol. 2014;173:258–69.View ArticlePubMedGoogle Scholar
  34. Wang XM, Niu BB, Yan H, Gao DS, Yang X, Chen L, et al. Genetic properties of endemic Chinese porcine epidemic diarrhea virus strains isolated since 2010. Arch Virol. 2013;158:2487–94.Google Scholar
  35. Chen X, Yang J, Yu F, Ge J, Lin T, Song T. Molecular characterization and phylogenetic analysis of porcine epidemic diarrhea virus (PEDV) samples from field cases in Fujian, China. Virus Genes. 2012;45:499–507.View ArticlePubMedGoogle Scholar
  36. Tian Y, Yu Z, Cheng K, Liu Y, Huang J, Xin Y, et al. Molecular characterization and phylogenetic analysis of new variants of the porcine epidemic diarrhea virus in Gansu, China in 2012. Viruses. 2013;5:1991–2004.View ArticlePubMedPubMed CentralGoogle Scholar
  37. Li ZL, Zhu L, Ma JY, Zhou QF, Song YH, Sun BL, et al. Molecular characterization and phylogenetic analysis of porcine epidemic diarrhea virus (PEDV) field strains in south China. Virus Genes. 2012;45:181–5.View ArticlePubMedGoogle Scholar
  38. Liu C, Tang J, Ma Y, Liang X, Yang Y, Peng G, et al. Receptor usage and cell entry of porcine epidemic diarrhea coronavirus. J Virol. 2015;89:6121–5.View ArticlePubMedPubMed CentralGoogle Scholar
  39. Deng F, Ye G, Liu Q, Navid MT, Zhong X, Li Y, Wan C, Xiao S, He Q, Fu ZF, Peng G. Identification and comparison of receptor binding characteristics of the spike protein of two porcine epidemic diarrhea virus strains. Viruses. 2016;8:55. doi:10.3390/v8030055.View ArticlePubMedPubMed CentralGoogle Scholar
  40. Chen X, Zeng L, Yang J, Yu F, Ge J, Guo Q, et al. Sequence heterogeneity of the ORF3 gene of porcine epidemic diarrhea viruses field samples in Fujian, China, 2010–2012. Viruses. 2013;5:2375–83.View ArticlePubMedPubMed CentralGoogle Scholar

Copyright

© The Author(s). 2016

Advertisement