Skip to main content

Table 1 Primers used in this study

From: Detection and phylogenetic analysis of porcine epidemic diarrhea virus in central China based on the ORF3 gene and the S1 gene

Primer name Nucleotide sequence, 5′-3′ Size(bp) Primer locationa
PEDV-F TTTATTCTGTCACGCCAT 197 2,2709–22,726
PEDV-R AGATTTACAAACACCTATGTTA   22,884–22,905
S1U1-F GGTAAGTTGCTAGTGCGTAA 1461 20,570–20,589
S1U1-R CAGGATCATCACAATAAAGAA 22,010–22,030
S1U2-F TTTCTGGACCATAGCATC 1117 21,939–21,956
S1U2-R AGCACAATCAACACTAAC 23,038–23,055
ORF3-F TCCTAGACTTCAACCTTACG 833 24,741–24,760
ORF3-R GGTGACAAGTGAAGCACAGA 25,551–25,570
  1. aIn relation to the genome of PEDV CV777 strain (AF353511)