Open Access

A duplex, SYBR Green I-based RT-qPCR assay for the simultaneous detection of Apple chlorotic leaf spot virus and Cherry green ring mottle virus in peach

  • Zhe Zhao1, 2,
  • Yun Yu2,
  • Zhixiang Zhang2,
  • Pengbo Liang1, 2,
  • Yuxin Ma2,
  • Shifang Li2 and
  • Hongqing Wang1Email author
Virology Journal201310:255

https://doi.org/10.1186/1743-422X-10-255

Received: 6 May 2013

Accepted: 7 August 2013

Published: 10 August 2013

Abstract

Background

Co-infections of Apple chlorotic leaf spot virus (ACLSV) and Cherry green ring mottle virus (CGRMV) in peach is common in China and have resulted in significant yield reductions. A reliable, sensitive and quantitive method is needed to detect and distinguish between ACLSV and CGRMV in peach.

Findings

We developed a sensitive and specific SYBR Green-I based RT-qPCR for the quantification of ACLSV and CGRMV in different peach tissues, and a duplex RT-qPCR system to detect ACLSV and CGRMV simultaneously. The RT-qPCR method was optimized using standard samples transcribed by the T7 Large Scale RNA Production System in vitro. The peach genes, RNA Polymerase subunit II (RPII) and Ubiquitin 10 (UBQ10), which were used as the internal controls for the quantification assay also showed good expression stability in this system. Single RT-qPCR assays showed that CGRMV in peach accumulates to a higher level than ACLSV. The detection limits of the duplex RT-qPCR assay were 102 and 104 copies for ACLSV and CGRMV, respectively. The sensitivity of the duplex RT-qPCR was as high as RT-qPCR and higher than RT-PCR.

Conclusions

The SYBR Green-I RT-qPCR assay provided a sensitive, specific and reliable method for the detection and quantification of ACLSV and CGRMV in different peach tissues. The duplex RT-qPCR system provided a sensitive and specific method to detect and differentiate between ACLSV and CGRMV in a single sample. This RT-qPCR assay could be a useful tool for the routine diagnosis of these two viruses and for disease epidemiology studies in peach orchards.

Keywords

ACLSVCGRMVSYBR Green IDuplex real-time PCRRT-qPCR

Main text

Apple chlorotic leaf spot virus (ACLSV) and Cherry green ring mottle virus (CGRMV) have been detected worldwide and display a broad host range on pome and stone fruit trees [1]. However, as ACLSV is present in infected trees at a low concentration [2], and the two viral infections are also normally latent in some stone fruits [24], a sensitive and effective system is needed to detect ACLSV and CGRMV in stone fruits. Multiple viral infections are common in stone fruit trees [5, 6]. Field surveys of peach viruses showed that some peach trees were infected with both ACLSV and CGRMV in China (unpublished data). Recently, three articles have reported plant virus detection using multiple RT-qPCR assays [79]. Therefore, we initiated this study to develop a method to determine the absolute copy numbers of ACLSV and CGRMV genomes in peach tissues, and to evaluate a duplex SYBR Green I-based RT-qPCR assay for the detection of ACLSV and CGRMV in a single reaction.

A total of 99 samples from leaf, branch bark, and flowers of peach infected with ALCSV and/or CGRMV and 34 leaf samples that showed mosaic symptoms were collected in China in 2012. Total RNAs were extracted from the tissue samples using the RNAprep Pure Plant Kit protocol (Tiangene, Beijing, China). A spectrophotometer (NanoDrop Technologies, USA) was used to quantify the RNA samples and determine their quality (an A260/A280 ratio between 1.9 and 2.1, and an A260/A230 ratio greater than 2.0).

Primer pairs AC84F/AC84R and CG94F/CG94R (Table 1) were used for normal PCR and predicted to amplify parts of the coat protein (CP) gene fragment (genomic locations 6,735-7,512 and 7,306-8235, respectively) of ACLSV and CGRMV, respectively. Each amplified DNA fragment was purified using a PCR purification kit (Axygen, Hangzhou, China) and inserted into the pGEM-T vector (Promega, USA). Purified recombinant plasmid DNA was linearized by restriction enzyme cleavage before in vitro transcription. Positive-strand RNA was transcribed using the RiboMAX Large Scale RNA Production Systems-T7 Kit (Promega, Madison, WI, USA). A RNA purification protocol (Promega) was used to remove the DNA template.
Table 1

Primer sequences and amplicon characteristics for PCRs

PCR type

Name

Locus description

Primer Sequence (5’-3’)

Product size (bp)

Product TM (°C)

RT-qPCR Efficiency (%)

R2

Concentration (nM)

qPCRa

AC62F

Coat protein

AAATACCCGGAGCTGATGTTTG

138

79.40 ± 0.24

97.0

0.9989

250

AC62R

CTTCGCCTCATTTTCACTCTTTG

250

CG732F

Coat protein

CAATTCAGGAGACGAACCCAG

181

81.44 ± 0.37

101.0

0.9939

250

CG732R

TTCCCGACCATCTTTGTTTTG

250

RPIIF

RNA polymerase subunit

TGAAGCATACACCTATGATGATGAAG

128

79.41 ± 0.29

93.6

0.9996

250

RPIIR

CTTTGACAGCACCAGTAGATTCC

250

UBQ10F

Ubiquitin 10

AAGGCTAAGATCCAAGACAAAGAG

146

84.36 ± 0.12

98.5

0.9958

500

UBQ10R

CCACGAAGACGAAGCACTAAG

500

nPCRb

AC84F

Coat proteinc

TCTGCAAGAGAATTTCAGTT

777

\

\

\

\

AC84R

GTCTACAGGCTATTTATTATAAG

\

\

\

\

CG94F

Coat proteind

CCTCATTCACATAGCTTAGGTTT

929

\

\

\

\

 

CG94R

 

ACTTTAGCTTCGCCCCGTG

 

\

\

\

\

aquantitative PCR; bnormal PCR; cgenomic location 6735–7512, GenBank accession JN634761; dgenomic location 7306–8235, GenBank accession JX501671.

The sequences of primers used in the RT-qPCR assay are listed in Table 1. Both sets of primers were tested against each other and other major peach viruses by RT-PCR, and all of the results were negative (data not shown). This indicated that both sets of primers are highly specific for the viral sequences from which they were designed.

Two internal control genes, RNA Polymerase subunit II (RPII) and Ubiquitin 10 (UBQ10) (peach EST database accession numbers TC1717 and TC2782, respectively), were used to evaluate the RT-qPCR assays as UBQ10 and RPII are abundantly and constantly transcribed in all peach samples [10]. RNA extraction errors can be eliminated through the use of data analysis by the quantification of UBQ10 and RPII expression.

RNA templates for standard curves of the four genes were generated using the in vitro transcription method described by Zhang et al. in 2008 [11]. The purified RNA was quantified using the NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies) and diluted 10-fold before use. One-step RT-qPCR reactions were performed using the GoTaq® 1-Step RT-qPCR System (Promega) according to manufacturer’s instructions. The final concentration of the AC62F, AC62R, CG732F, CG732R, RPIIF and RPIIR primers was 50 nM, whereas UBQ10F and UBQ10R were used at 100 nM. All of these concentrations had good levels of amplification efficiency (Figure 1).
Figure 1

Standard curves for SYBR Green I-based real-time RT-PCR amplification of standard ACLSV, CGRMV, RPII and UBQ10 RNA with specific primer pairs (see Table1). Amplification plots showing the testing in duplicate of a 10-fold dilution series containing (A) standard ACLSV RNA from 1.08 × 109 to 1.08 × 102 template copies/reaction, (B) standard CGRMV RNA from 1.13 × 1010 to 1.13 × 104 template copies/reaction, (C) standard RPII RNA from 2.09 × 1013 to 2.09 × 108 template copies/reaction, and (D) standard UBQ10 RNA from 1.90 × 1012 to 1.90 × 106 template copies/reaction.

The analytical sensitivities or detection limits of single RT-qPCR assays were determined by amplifying sequential 10-fold dilutions of quantified standard RNA. Four RNA standard curves were generated with primers and templates using the protocol described above (Figure 1). The standard curves for ACLSV, CGRMV, RPII, and UBQ10 covered a linear range of eight, six, six and seven orders of magnitude (Figure 1A-D, respectively). The slopes and the correlation coefficients (R2) of the standard curves for ACLSV, CGRMV, RPII and UBQ10 were suitable, as shown as Figure 1. This finding indicated that both the target RNAs in infected peach tissue and the reference RNAs could be quantified by these assays. This assay system proved to be highly sensitive, and could be used to detect ACLSV starting with as little as 102 copies, and 104 copies at CGRMV.

Single RT-qPCR was used to quantify genomic RNA copies of ACLSV and CGRMV and mRNA copies of RPII and UBQ10 in different peach tissues. RPII and UBQ10 mRNAs were quantified by this method to ensure that the assay system was reproducible. The number of copies per 100 ng of total RNA was given in Table 2. The coefficient of variation (CV) of the RPII and UBQ10 assays (Table 1) showed a lower relative standard deviation, which suggested the RNA extraction and RT-qPCR methods were optimal for the quantification of ACLSV and CGRMV. This finding also showed that, as housekeeping genes, RPII and UBQ10 were stably expressed genes across all of the tissues examined [10]. In the ACLSV assay, the copy numbers were 1.12 × 106 ± 1.82 × 105 in leaf, 2.14 × 106 ± 5.13 × 105 in bark and 1.38 × 107 ± 3.31 × 106 in the flower. In the CGRMV assay, the copy numbers were 4.07 × 108 ± 4.17 × 107 in leaf, 5.62 × 108 ± 6.92 × 107 in bark and 2.51 × 108 ± 6.92 × 107 in the flower. All data suggested that the absolute copy numbers of the ACLSV genome in leaf, bark and flower tissues of peach were lower than those of CGRMV. This result confirmed previous speculation regarding the low titer of ACLSV in stone fruit trees, and could to some extent explain the reason for the phenomenon of latent infection by ACLSV in stone fruits [2, 3]. CGRMV has a relatively higher titer in bark, which was similar to the results found for Citrus tristeza virus in different citrus tissues [12], whereas the copy number of ACLSV is highest in flowers.
Table 2

ACLSV and CGRMV genomic RNA copy numbers in three peach tissues

 

Ct value (X ± S.D.)a [Number of copies (X ± S.E.)]b

 

ACLSV

CGRMV

RPII

UBQ10

Leaf

23.32 ± 0.24c [1.12 × 106 ± 1.82 × 105]

18.66 ± 0.23f [4.07 × 108 ± 4.17 × 107]

17.16 ± 0.23i [2.45 × 109 ± 2.64 × 108]

18.67 ± 0.18l [3.39 × 109 ± 3.02 × 108]

Bark

22.38 ± 0.36d [2.14 × 106 ± 5.13 × 105]

18.18 ± 0.30g [5.62 × 108 ± 6.92 × 107]

17.46 ± 0.44j [2.04 × 109 ± 4.16 × 108]

19.02 ± 0.30m [2.68 × 109 ± 3.89 × 108]

Flower

19.61 ± 0.35e [1.38 × 107 ± 3.31 × 106]

19.37 ± 0.40h [2.51 × 108 ± 6.92 × 107]

17.76 ± 0.49k [1.68 × 109 ± 3.78 × 108]

19.90 ± 0.41n [1.47 × 109 ± 2.91 × 108]

aAverage threshold cycle (Ct) and standard deviation (S.D.) obtained from 33 different samples.

bAverage number of RNA copies (X) per sample and standard error (S.E.).

c-nCoefficient of variation (CV%) between assays: c = 1.02, d = 1.59, e = 1.76, f = 0.80, g = 1.59, h = 1.76, i = 0.70, j = 1.35, k = 1.51, l = 0.57, m = 0.95, n = 1.33.

A duplex SYBR Green-I RT-qPCR assay was developed to address the observation that peach trees are often infected by both ACLSV and CGRMV (unpublished data). As shown in Figure 2A, ACLSV and CGRMV could be discriminated in a duplex RT-qPCR reaction by melting curve analysis of the specific amplification products from the single RT-qPCR reactions. Specific melt peaks for ACLSV (T = 79.2°C) and CGRMV (T = 81.4°C) were obtained from the duplex RT-qPCR (Figure 2A). Also, the amplification products observed in the duplex RT-qPCR reaction were amplified using single RT-qPCR assays and had nearly identical melting peaks: 79.6°C for ACLSV and 81.2°C for CGRMV (Figures 2B and D). It can be seen from Figure 2A that the -d(RFU)/dT values for the ACLSV- and CGRMV-specific DNA fragments in the duplex RT-qPCR assay were similar to those in single RT-qPCR assays (Figures 2B and D), which indicated that the duplex assay can be used for the simultaneous detection of ACLSV and CGRMV. Healthy peach RNA (hpRNA) was used as the template in negative control (NC) reactions with the primer pairs AC62F/AC62R and CG732F/CG732R (Figure 2C). From this plot, the -d(RFU)/dT value of the primers was lower than 50, which was much lower than that of ACLSV or CGRMV, and showed a similar value to that shown in Figures 2A, B and D. The melting curve of the NC reactions with hpRNA and AC62F/AC62R or CG732F/CG732R primers resulted in a similar curve to that shown in Figure 2C (data not shown). These results suggested that primer dimers did not affect the PCR assays, and also showed that both of the primer pairs used for ACLSV and CGRMV detection were highly specific. We collected 34 field peach samples showing mosaic symptoms that were suspected to be infected with ACLSV and/or CGRMV from three sites in China (Table 3). ACLSV was detected in eight samples by RT-PCR and in ten samples by single and duplex RT-qPCR; five samples were CGRMV-positive by RT-PCR and six samples by single and duplex RT-qPCR. This result showed that single and duplex RT-qPCR assays are more sensitive than normal RT-PCR, and as a stable and effective detection system, the duplex RT-qPCR assay can be used to screen putatively infected peach trees in field.
Figure 2

Melting curve analysis for duplex RT-qPCR (A), single RT-qPCR (B and D), and no template RT-qPCR (C) as the negative control tested for ACLSCV and/or CGRMV. Figure 2C shows the melting curve assay for primer pairs AC62F/AC62R and CG732F/CG732R; RNA from healthy peach tissue was used as a template.

Table 3

Results of RT-PCR, single RT-qPCR and duplex RT-qPCR detection of samples from different places infected with ALCSV and/or CGRMV

No.

Location

RT-PCR

Single RT-qPCR

Duplex RT-qPCR

  

ACLSV

CGRMV

ACLSV

CGRMV

ACLSV

CGRMV

1

Qingdao

 

+

 

+

 

+

2

Qingdao

      

3

Qingdao

  

+

 

+

 

4

Qingdao

      

5

Qingdao

      

6

Qingdao

+

+

+

+

+

+

7

Qingdao

      

8

Qingdao

   

+

 

+

9

Qingdao

      

10

Qingdao

+

 

+

 

+

 

11

Qingdao

      

12

Qingdao

  

+

 

+

 

13

Qingdao

      

14

Shijiazhuang

+

 

+

 

+

 

15

Shijiazhuang

      

16

Shijiazhuang

+

 

+

 

+

 

17

Shijiazhuang

      

18

Shijiazhuang

 

+

 

+

 

+

19

Shijiazhuang

      

20

Shijiazhuang

      

21

Shijiazhuang

      

22

Shijiazhuang

      

23

Taian

+

 

+

 

+

 

24

Taian

      

25

Taian

      

26

Taian

      

27

Taian

      

28

Taian

+

+

+

+

+

+

29

Taian

      

30

Taian

+

 

+

 

+

 

31

Taian

      

32

Taian

      

33

Taian

      

34

Taian

+

+

+

+

+

+

Total

 

8

5

10

6

10

6

Recently TaqMan-based multiplex RT-qPCR assays were used to detect viruses in tobacco, grapevine and rice [79]. SYBR Green-I multiplex RT-qPCR assays were developed for the simultaneous detection and quantification of animal viruses [13, 14], and demonstrated that this strategy provides a reliable method for the detection and differentiation of nucleic acid targets. It also showed that multiple SYBR Green I-based RT-qPCR assays can retain a high level of sensitivity required for detection. Here, we described the detection of plant viruses using SYBR Green-I RT-qPCR assays, which have the advantages of economical and rapid identification of desired target genes. The duplex RT-qPCR assay and quantification of ACLSV and CGRMV titers in infected peach trees will provide a new method for the reproducible, sensitive and rapid detection of ACLSV and CGRMV. This will help to provide new insights into the biology of ACLSV and CGRMV that are necessary for disease control.

Declarations

Acknowledgements

This work was supported by grants from the Earmarked Fund for China Agriculture Research System (CARS-31), the Special Fund for Agro-scientific Research in the Public Interest (Nos. 201203076 and 200903004), the National Basic Research and Development Program of China (973 Program) (No. 2009CB119200) and the National Natural Science Foundation of China (Nos. 31171819 and 31000842).

Authors’ Affiliations

(1)
College of Agronomy and Biotechnology, China Agricultural University
(2)
Institute of Plant Protection, Chinese Academy of Agricultural Sciences, State Key Laboratory of Biology of Plant Diseases and Insect Pests

References

  1. Sutic DD, Ford RE, Tosic MT: Virus diseases of fruit trees. Handbook of plant virus diseases, 1st edn. CRC Press 1999, 345-347.Google Scholar
  2. Polák J, Svoboda J: The reliability of detection and the distribution of Apple chlorotic leaf spot virus in pears in the Czech Republic. Hort Sci 2006, 33: 7-10.Google Scholar
  3. Ulubas C, Ertunc F: Apple Chlorotic Leaf Spot Virus (ACLSV) status in Turkey and sensitive detection using advanced techniques. Turk J Agric For 2005, 29: 251-257.Google Scholar
  4. Zhang YP, Kirkpatrick BC, Smart CD, Uyemoto JK: cDNA cloning and molecular characterization of cherry green ring mottle virus. J Gen Virol 1998, 79: 2275-2281.PubMedView ArticleGoogle Scholar
  5. Jarošová J, Kundu JK: Simultaneous detection of stone fruit tree viruses by one-step multiplex RT-PCR. Sci Hortic 2010, 125: 68-72. 10.1016/j.scienta.2010.02.011View ArticleGoogle Scholar
  6. Sanchez-Navarro JA, Aparicio F, Herranz MC, Minafra A, Myrta A, Pallas V: Simultaneous detection and identification of eight stone fruit viruses by one-step RT-PCR. Eur J Plant Pathol 2005, 111: 77-84. 10.1007/s10658-004-1422-yView ArticleGoogle Scholar
  7. Dai J, Peng H, Chen W, Cheng J, Wu Y: Development of multiplex real-time PCR for simultaneous detection of three Potyviruses in tobacco plants. J Appl Microbiol 2012. 10.1111/jam.12071Google Scholar
  8. López-Fabuel I, Wetzel T, Bertolini E, Bassler A, Vidal E, Torres LB, Yuste A, Olmos A: Real-time multiplex RT-PCR for the simultaneous detection of the five main grapevine viruses. J Virol Methods 2012. 10.1016/j.jviromet.2012.11.034Google Scholar
  9. Zhang P, Mar TT, Liu WW, Li L, Wang XF: Simultaneous detection and differentiation of Rice black streaked dwarf virus (RBSDV) and Southern rice black streaked dwarf virus (SRBSDV) by duplex real time RT-PCR. Virol J 2013, 10: 24. 10.1186/1743-422X-10-24PubMedPubMed CentralView ArticleGoogle Scholar
  10. Tong Z, Gao Z, Wang F, Zhou J, Zhang Z: Selection of reliable reference genes for gene expression studies in peach using real-time PCR. BMC Mol Biol 2009, 10: 71. 10.1186/1471-2199-10-71PubMedPubMed CentralView ArticleGoogle Scholar
  11. Zhang X, Wang X, Zhou G: A one-step real time RT-PCR assay for quantifying rice stripe virus in rice and in the small brown planthopper (Laodelphax striatellus Fallen). J Virol Methods 2008, 151: 181-187. 10.1016/j.jviromet.2008.05.024PubMedView ArticleGoogle Scholar
  12. Ruiz-Ruiz S, Moreno P, Guerri J, Ambrós S: A real-time RT-PCR assay for detection and absolute quantitation of Citrus tristeza virus in different plant tissues. J Virol Methods 2007, 145: 96-105. 10.1016/j.jviromet.2007.05.011PubMedView ArticleGoogle Scholar
  13. Pérez LJ, Perera CL, Frías MT, Núñez JI, Ganges L, de Arce HD: A multiple SYBR Green I-based real-time PCR system for the simultaneous detection of porcine circovirus type 2, porcine parvovirus, pseudorabies virus and Torque teno sus virus 1 and 2 in pigs. J Virol Methods 2012, 179: 233-241. 10.1016/j.jviromet.2011.11.009PubMedView ArticleGoogle Scholar
  14. Pripuzova N, Wang R, Tsai S, Li B, Hung GC, Ptak RG, Lo SC: Development of Real-Time PCR Array for Simultaneous Detection of Eight Human Blood-Borne Viral Pathogens. PLoS One 2012. 10.1371/journal.pone.0043246Google Scholar

Copyright

© Zhao et al.; licensee BioMed Central Ltd. 2013

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement