Influenza challenge study design and sample collection
During a volunteer influenza challenge study (ClinicalTrials.gov Identifier: NCT02918006) [12], 143 volunteers with low levels of pre-existing antibodies (HAI titers of less than 1:20) were challenged intranasally with an identical dose of A/California/2009/H1N1 challenge virus stock (a post-hoc qPCR assay determined each dose to be between 5.50 × 105 to 3.5 × 106 TCID50 units [12]. This same dose of this same virus stock was sufficient to result in virus shedding in 67% of healthy volunteers in a prior dose-ranging study [13]. The presence of virus shedding was strongly correlated with the appearance of volunteer reported symptoms. Please see Liebowitz et al. [12] for additional details on symptomology, inclusion criteria, demographics of volunteers, and other information. Nasopharyngeal (NP) swabs (Quidel, San Diego, CA) were collected up to twice daily by inserting the swab into the nasopharynx and turning before placement in a supplied tube containing universal virus transport medium. NP swab specimens were used for the detection of virus shedding by a validated qPCR assay (qPCR) throughout the study. Starting on day 4 post virus challenge, matched NP swabs were collected from individual volunteers at each time point and the presence of virus was evaluated using a qPCR assay and either the BioMerieux BioFire FilmArray RP (BioFire) or Quidel QuickVue Influenza A + B Test (rapid test).
Quantitative real-time PCR (qPCR) assay and qualification
A real-time PCR (qPCR) method was adapted from a method developed at the US Centers for Disease Control and Prevention (CDC) and validated at the Laboratory for Specialized Clinical Studies at Cincinnati Children’s Hospital Medical center. The assay detected and quantified shedding of Influenza A/California/04/2009 H1N1 virus in clinical samples. Nucleic acid extraction of 140µL of the NP swab samples was carried out by use of the Qiagen QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany). Primers and probes (Biosearch Technologies, Inc, Novato, CA) targeting the HA gene of the pandemic (pdmH1) influenza A (H1N1) 2009 virus were used (Additional file 1: Table S1). To evaluate the quality of the NP swab samples, a separate PCR reaction was performed to detect the Human RNPase P gene. Detection of this gene confirms that the swab sample is of sufficient quality that cell-associated virus can be detected and quantified and acts as an internal control for any possible PCR inhibitors in the swab sample. A one-step quantitative RT-probe Hydrolysis kit, Ambion AgPath-ID™ One-Step kit (Thermo Fisher, Waltham, MA) was used in the PCR reaction following the manufacturer’s instructions. The final concentration of primers was 0.8 µM and 0.2 µM for the probe. 5µL of the extracted material was used in each reaction. PCR conditions using an Applied Biosystems ABI 7500 PCR system (Thermo Fisher, Waltham, MA) were as follows: 50.0 °C for 30 min; 95.0 °C for 10 min; 45 cycles of 95 °C, 15 s followed by 55 °C for 34 s.
To develop a standard curve for quantitation, the HA gene sequence was obtained from GenBank (KU933485.1) for A/California/07/2009. A forward primer at positions 1–25 (ATGAAGGCAATACTAGTAGTTCTGC) with a 5′ T7 promoter and a reverse primer at positions 1702–1673 (TTAAATACATATTCTACACTGTAGAGACCC) were used to generate a transcript of 1702 base pairs in a one-step RT PCR reaction. The product was run on a 1% gel and the band was purified with the Zymoclean Gel DNA Recovery Kit (Zymo Research, Irvine, CA). A Megascript T7 transcription kit (Thermo Fisher, Waltham, MA) was used to generate an RNA transcript. The transcript was cleaned up using the Qiagen RNeasy Mini Kit (Qiagen, Hilden, Germany), run on a 1% agarose gel to confirm the size, and then quantified by multiple readings on a Nanodrop. The concentration and copy number were calculated from the OD readings. Standard curves were generated by freshly diluting transcripts tenfold from 4.0 × 106 to 4.0 copies/µL (2.0 × 107 to 20.0 copies/reaction) before each run. Standard curves were shown to have an average efficiency of 100% based on the slope of the curves. A positive control of extracted A/California/04/2009 H1N1 virus was run in the reaction over 20 times by two technicians over a 5-week period to obtain data to set an acceptance range based on 2 standard deviations of the average quantity obtained in the assay.
To confirm specificity towards A/California H1N1, eight different influenza A and B viruses (Additional file 2: Table S2) were tested in the assay. Only A/California H1N1 specific isolates were detected in the assay. Additionally, to demonstrate the specificity of the primers and probe, the PCR product of the positive virus control was run on a 2% agarose gel and assessed for a band at 177 bp to confirm that only the targeted portion of the gene was amplified (Additional file 3: Figure S1). Intra- assay precision and intermediate precision was determined to have a coefficient of variance (CV) of 11% and 25%, respectively.
The limit of detection (LOD) for the assay was determined from running the standard reference in two-fold dilutions surrounding the lower end of the standard curve in replicates of 20. The LOD was then calculated as the concentration where 95% of the reference standard dilutions gave a positive response (Ct ≤ 40). The LOD was calculated to be 16 copies/reaction. For purposes of comparison with BioFire or rapid test, qPCR samples above the LOD were considered positive, samples below the LOD were considered to be negative.
BioFire FilmArray
NP swab samples were loaded into the Biofire FilmArray respiratory panel cassette according to the manufacturer’s instructions and analyzed using the BioFire FilmArray Multiplex PCR System (BioMerieux, Marcy-l'Étoile, France) [14]. This device uses a fully automated procedure for nucleic acid purification, amplification, multiplexed PCR, and melting analysis, and generates a report with binary outcomes for various respiratory pathogens. Within assay cassettes are two positive quality controls, the first is an RNA process control to verify successful extraction and reverse transcription, the second is an independent DNA control to verify a successful PCR reaction occurred [14]. All samples analyzed in this study passed both quality controls, and those that were positive for influenza A were considered positive in this report. Samples that were positive for targets other than influenza A were excluded from analysis while all other samples were considered negative.
Rapid influenza test
NP swab samples were applied to the QuickVue Influenza A + B Test (Quidel, San Diego, CA) using the manufacturer’s instructions [15]. Colorimetric tests were read by eye to determine positive or negative results as per protocol in the test kit insert. All samples reported in this analysis properly displayed positive procedural control lines, indicating successful execution of the test kit protocol [15].
Statistical analysis
Sensitivity (true positive rate) was calculated as the ratio of true positive results divided by the sum of true positive and false negative results [(true positive)/(true positive + false negative)]. The specificity (true negative rate) was calculated by dividing the number of true negative results by the total number of true negative plus false-positive results [(true negative)/(true negative + false positive)]. The positive and negative predictive values were calculated as true positive divided by all positive results and true negative divided by all negative results, respectively. The confidence interval was calculated using the epiR package [16]. Differences in qPCR copy number values between samples determined to be true positive and false negative by BioFire or rapid test were calculated using the Wilcoxon signed-rank test on log 10 values.
