Skip to content

Advertisement

  • Short report
  • Open Access

A new hepatitis E virus genotype 2 strain identified from an outbreak in Nigeria, 2017

  • 1,
  • 1,
  • 1,
  • 1,
  • 1, 2,
  • 3,
  • 4,
  • 4,
  • 4,
  • 4,
  • 4 and
  • 1, 5Email authorView ORCID ID profile
Virology Journal201815:163

https://doi.org/10.1186/s12985-018-1082-8

  • Received: 12 September 2018
  • Accepted: 16 October 2018
  • Published:

Abstract

Background

In 2017 the Nigerian Ministry of Health notified the World Health Organization (WHO) of an outbreak of hepatitis E located in the north-east region of the country with 146 cases with 2 deaths. The analysis of the hepatitis E virus (HEV) genotypes responsible for the outbreak revealed the predominance of HEV genotypes 1 (HEV-1) and 2 (HEV-2). Molecular data of HEV-2 genomes are limited; therefore we characterized a HEV-2 strain of the outbreak in more detail.

Finding

The full-length genome sequence of an HEV-2 strain (NG/17–0500) from the outbreak was amplified using newly designed consensus primers. Comparison with other HEV complete genome sequences, including the only HEV-2 strain (Mex-14) with available complete genome sequences and the availability of data of partial HEV-2 sequences from Sub-Saharan Africa, suggests that NG/17–0500 belongs to HEV subtype 2b (HEV-2b).

Conclusions

We identified a novel HEV-2b strain from Sub-Saharan Africa, which is the second complete HEV-2 sequence to date, whose natural history and epidemiology merit further investigation.

Keywords

  • Hepatitis E virus
  • HEV genotype 2
  • HEV subtype 2b
  • Outbreak
  • Nigeria
  • Complete genome

Main text

Hepatitis E virus (HEV) is the prototype of the family Hepeviridae and a common causative agent of acute viral hepatitis. HEV is a small, (non)enveloped spherical particle of about 34 nm in diameter harboring a single stranded, positive sense RNA genome of approximately 7.5 kb [1]. Eight HEV genotypes are recognized within the species Orthohepevirus A based on the pairwise distances of entire viral genomes (HEV-1 to HEV-8). The different HEV genotypes have various reservoirs, distinct distribution, and transmission patterns. Four major HEV genotypes (HEV-1 to HEV-4) are well recognized as human pathogens while HEV-5 and HEV-6 have been detected only in wild boars so far. HEV-7 from dromedary camels has been reported to infect humans and cause chronic hepatitis E. HEV-8 is identified in Bactrian camels with an unknown zoonotic potential [24]. HEV-1 and HEV-2 are transmitted through the waterborne/fecal-oral route and responsible for large HEV outbreaks and epidemics in endemic areas like the Indian subcontinent and Africa, whereas HEV-3 and HEV-4 are linked to zoonotic transmission causing sporadic infections mainly in industrialized countries [5]. HEV-2 was firstly identified during a hepatitis E outbreak in Mexico in 1986 while the complete genome sequence (HPENSSP, GenBank accession No. M74506) was subsequently characterized [6]. Recently, additional HEV-2 full-length genome sequences were obtained from an individual patient of same Hepatitis E outbreak in Mexico (Mex-14, KX578717) showing 99.5% nucleotide identity to M74506 [7]. However, the sequences for M74506 and KX578717 are from the same isolate. Since M74506 has been referred to as Mexico [8], Mexico-14 [9], and Telixtac-14 [10], the stool sample was re-analysed at the Paul Ehrlich Institute (PEI), Germany, with the isolate designation Mex-14, and the sequences were submitted to GenBank receiving the accession number KX578717. Additionally, several studies have reported that HEV-2 is distributed in Africa. However, only partial ORF2 gene sequences were amplified [1114]. According to the report of Lu et al. and the International Committee on Taxonomy of Viruses (ICTV) Hepeviridae Study Group, Mex-14 is the proposed HEV subtype 2a (HEV-2a) reference sequence, and HEV subtype 2b (HEV-2b) was assigned to the partial sequences AF173231 and AF173232 from Nigeria and AY903950 from Chad [15, 16].

In June 2017, the Nigerian Ministry of Health reported to the World Health Organization (WHO) an HEV outbreak in north-east Nigeria, with 146 laboratory confirmed cases and two outbreak-associated cases of death in pregnant [17]. In order to identify the corresponding viral pathogens of this hepatitis E outbreak, we determined HEV genotypes from outbreak samples. The genotyping results showed mainly HEV-1 and HEV-2 strains being predominant within the outbreak, the genotype distribution of isolates from this outbreak as determined by the Nigerian center of disease control (NCDC) and Robert Koch Institute (RKI) was 40% HEV-1 and 60% HEV-2. However, a number of HEV-positive outbreak samples could not genotyped. Since full-length genome sequences of HEV-2 strains are rare, we here report the full-length genome sequence of the HEV-2 strain (NG/17–0500) from an isolate of the Nigerian outbreak. The virus was detected from an individual from Borno state, Nigeria, and initially tested serologically positive for HEV using Wantai HEV-IgM Rapid Test and Wantai HEV-IgM ELISA (Sanbio, Uden, Netherland).

Viral RNA from an anonymized serum sample (NG/17–0500) was extracted using High Pure Viral Nucleic Acid Kit (Roche, Mannheim, Germany) following cDNA synthesis using SuperScript™ III First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Molecular approaches with sensitive real-time PCR and consensus nested PCR assays were conducted as described recently [18]. To amplify the entire genome sequence of NG/17–0500 and to verify the geno/subtyping results, universal primers were designed based on 38 complete HEV-1 and HEV-2 sequences from the GenBank database. Using genome walking method, gene-specific primers were designed to amplify the gaps. Primers and probe used are listed in Table 1. The complete viral genome of NG/17–0500 was amplified using KAPA HiFi HotStart ReadyMix PCR kit (Roche, Mannheim, Germany). 5′ and 3′ sequences were determined using 5′ and 3′ rapid amplification of cDNA ends (Roche, Mannheim, Germany). Sense and antisense strands of PCR amplicons were sequenced with BigDye Terminator version 3.1 cycle sequencing kit (Thermo Fisher Scientific, USA). Whole genome sequence was assembled and analyzed using Geneious software version 10.0.5. (Biomatters Limited, Auckland, New Zealand) [19].
Table 1

Primers used for HEV quantification, genotyping, and complete genome sequencing

Primera

Sequence (5′-3′)

Locationb

Use

Reference

HEV-07_f

GGTGGTTTCTGGGGTGAC

5261–5278

HEV-1 to HEV-4 quantification

[18]

HEV-TM3_f

FAM-TGATTCTCAGCCCTTCGC-MGB

5284–5301

HEV-08_r

AGGGGTTGGTTGGATGAA

5330–5313

HEV-38_f

GARGCYATGGTBGAGAARG

4084–4102

HEV-1 to HEV-4 genotyping in ORF1

[18]

HEV-39_r

GCCATRTTCCARACRGTRTTCC

4622–4601

HEV-37_f

GGTTYCGYGCYATTGARAARG

4277–4297

HEV-27_r

TCRCCRGARTGYTTCTTCC

4583–4565

HEV-30_f

CCGACAGAATTRATTTCGTCGG

6296–6317

HEV-1 to HEV-4 genotyping in ORF2

HEV-32_f

GTCTCRGCCAATGGCGAGCCRRC

6350–6372

HEV-31_r

GTYTTRGARTACTGCTGR

6750–6733

HEV-266_f

GCARGCTGCTCTRGCWGCGGC

78–98

HEV-2 complete genome sequencing

This study

HEV-274_f

TGGTGGTTAGGCCTTTTCTCTC

122–143

HEV-275_f

CCGATCCAGCGTGTCATACATA

223–244

HEV-267_r

GGRGCWGWRTACCARCGCTG

392–373

HEV-268_f

AYCTYCGYGGYATTAGCTAYAAGG

1055–1078

HEV-276_r

CGTTGATGGCAAATTGTGAGGT

1178–1157

HEV-277_f

ATCTCTCGTCTCTACAGCTGGT

1246–1267

HEV-278_f

GGGCCGTCAGTTGCAATTTTAT

1299–1320

HEV-283_f

GTAGCTGCCGGACTATTGCT

1397–1416

HEV-270_r

ARCCACYKCATAAARCARC

1457–1439

HEV-284_f

ACCAGGGCCATGACAATGAG

1508–1527

HEV-285_r

GAGGCCTGGTCAGCAACTAG

2186–2164

HEV-271_f

AACCCMAAGAGGCUYGAGGC

2620–2639

HEV-272_f

GCCTGGGARCGKAAYCAYCG

2734–2753

HEV-279_f

TGTTCAACGTAGGATGATCCGG

2833–2812

HEV-280_f

TTTGAGCATACTGGTCTGGTCC

3220–3241

HEV-273_r

CARCGRUGKGURACAUGCCACC

3296–3275

HEV-235_r

CYGCCTGGGTGAACACTAG

3421–3403

HEV-265_f

ATGGGGACGCCTATGATGAATC

4337–4358

HEV-282_r

TTCTGGGTCGAGTCAAACTCAG

4439–4418

HEV-281_r

CACTCCTCCATAATAGCGCACT

4481–4460

HEV-286_f

TTCTGCTGTTGCTCCTCCTG

5169–5188

HEV-301_f

AGACGTCTGGTGTTGCTGAG

5937–5956

HEV-288_r

TTTACTGTCGGCTCGGCATT

6384–6365

HEV-287_r

GCTGGGCATTCTCCACAGAT

6413–6394

HEV-233_f

GCCTSTTTTGTGATGCGCG

6755–6773

aForward primer designations end with _f; reverse primer designations end with _r

bNumbering is according the HEV prototype strain Burma (GenBank accession No. M73218)

Real-time PCR assay targeting the HEV ORF2 and ORF3 overlapping region (ORF2/3) demonstrated viremic HEV infection with a viral load of 1.2 × 10E + 7 IU/mL. Sequence analysis of partial ORF1 and ORF2 genes indicated that NG/17–0500 preliminary belongs to HEV-2. After de novo assembly of the amplicons, the NG/17–0500 full-length sequence showed 7198 nucleotides, excluding the 3′-poly (A) tail, with a G + C content of 57.5% harboring the typical 3 HEV ORFs. Phylogenetic analysis of the complete genome sequence revealed that NG/17–0500 grouped with HEV-2 Mex-14 strain (Fig. 1a), and this was all true for phylogenetic analysis of individual ORFs (data not shown). These relationships were also observed for sequence identities between NG/17–500 and other HEV complete genome or nucleotide or amino acid sequence identities of individual ORFs (Table 2).
Fig. 1
Fig. 1

Phylogenetic relationships of NG/17–0500 within the species Orthohepevirus A. HEV-2 strains are designated with geno/subtype, accession number, country, and collection year. NG/17–0500 of this study is shown in red. Phylogenetic analyses were performed with MEGA software version 7.0.26. Maximum likelihood trees based on General Time Reversible model with Gamma distributed with Invariant sites was inferred. The values at nodes indicate the bootstrap values (using 1000 replications). Values below 70% are hidden for clarity of presentation. Reference sequences for HEV genotypes were as proposed from the ICTV Hepeviridae Study Group. Nucleotide (nt) and amino acid (aa) sequences were aligned using MAFFT software version 7.222. a Phylogenetic relationships based on complete genome sequences of representative HEV reference strains. HEV-2 strains are highlighted with red branches. b Phylogenetic relationships based on 641 nt of ORF 2 corresponding to nt positions 6453 to 7093 (numbered according to the HEV prototype strain from Burma GenBank accession No. M73218). HEV-2b strains are highlighted with red branches

Table 2

Nucleotide and amino acid sequence identities between NG/17–0500 and reference HEV strains within the family Hepeviridaea

Hepeviridae

Degree of identity (%)

Complete genome

ORF1

ORF2

ORF3

ntb

nt

aa

nt

aa

nt

aa

HEV-1

75.0

72.3

83.5

81.0

94.8

90.9

87.8

HEV-2

83.5

82.3

92.7

86.8

98.2

94.1

91.1

HEV-3

73.1

71.2

81.5

78.7

91.2

83.9

76.4

HEV-4

73.5

71.1

80.6

80.7

91.1

80.6

78.9

HEV-5

72.6

70.1

80.1

78.6

89.1

75.0

74.1

HEV-6

72.8

70.9

79.4

78.0

88.5

75.5

70.5

HEV-7

72.3

69.8

80.6

78.8

89.8

79.0

79.8

HEV-8

72.2

70.0

79.9

77.9

89.4

78.5

81.6

Avian HEV

46.3

44.9

41.3

46.2

43.3

25.6

21.1

Rat HEV

52.1

50.1

48.0

55.1

54.8

38.1

27.1

Bat HEV

47.2

45.8

41.6

55.1

48.1

30.6

15.9

aThe sequences were aligned using MAFFT software version 7.222. The evolutionary analyses were conducted using MEGA 7 software version 7.0.26. The GenBank accession numbers are for HEV-1 (M73218), HEV-2 (KX578717), HEV-3 (AF082843), HEV-4 (AJ272108), HEV-5 (AB573435), HEV-6 (AB602441), HEV-7 (KJ496143), HEV-8 (KX387865), Avian HEV (AY535004), Rat HEV (GU345042), and Bat HEV (JQ001749)

bnt and aa represent nucleotide and amino acid, respectively

Due to inadequate sanitation and lack of clean drinking water, hepatitis E is a severe public health issue in several regions of Africa [20]. Partial HEV-2 sequences have been reported from Sub-Sahara African countries mainly during HEV outbreaks including Namibia in 1995 [12], Sudan in 2004 [13], and the Central African Republic in 2002 [14]. In addition, a single study reported of the analysis of HEV isolates from ten sporadic cases in Port-Harcourt city, southern Nigeria in 1997. Phylogenetic analysis of partial ORF2 fragments indicated that the Nigerian isolates from 1997 are most closely related to the HEV-2a reference Mex-14 strain and have been proposed as HEV-2b [11, 15, 16]. In this regard, comparison of NG/17–0500 sequence to the previously characterized Nigerian HEV-2b isolates displayed a 91.2% to 92.2% nt identity. Phylogenetic analysis of the availability of data of partial HEV-2 sequences from Sub-Saharan Africa showed that NG/17–0500 clustered with proposed HEV-2b sequences, indicating NG/17–0500 belongs to HEV-2b (Fig. 1b). Comparison of partial ORF2 sequences of NG/17–0500 to Chad (AY903950) and Central African Republic (DQ151640) HEV-2b isolates shared 90.3% and 88.4% identity, respectively. No evidence of recombination in NG/17–500 was detected by either Identity Plot or Bootscan analysis (Fig. 2). The complete genome sequence of NG/17–0500 has been deposited in GenBank under the accession number MH809516.
Fig. 2
Fig. 2

Detection of potential recombination events of NG/17–0500 within HEV-1 to HEV-4. a Identity Plot and b BootScan analyses of full-length sequences were performed using SimPlot software program version 3.5.1 with an F84 distance model, a sliding window size of 300 base pairs and a step size of 15 base pairs increment. Positions containing gaps were stripped from the alignment

In conclusion, to the best of our knowledge the novel HEV-2b strain NG/17–0500 from Nigerian hepatitis E outbreak 2017 represents the first complete HEV-2 genomic sequence from Sub-Sahara Africa and the second complete HEV-2 sequence worldwide, which contributes to our knowledge of the diversity of HEV-2. Nevertheless, the natural history of NG/17–0500 requires further comprehensive genetic and epidemiological analyses.

Notes

Abbreviations

aa: 

Amino acid

HEV: 

Hepatitis E virus

HEV-1 to HEV-8: 

Hepatitis E virus genotype 1 to hepatitis E virus genotype 8

HEV-2a and HEV-2b: 

Hepatitis E virus subtype 2a and 2b

ICTV: 

International Committee on Taxonomy of Viruses

NCDC: 

Nigerian center of disease control

nt: 

Nucleotide

ORF: 

Open reading frame

PEI: 

Paul Ehrlich Institute

RKI: 

Robert Koch Institute

WHO: 

World Health Organization

Declarations

Acknowledgments

We are grateful for the excellent technical assistance of Marcel Schulze and Steffen Zander (RKI).

Funding

This research was supported by the Global Outbreak Alert and Response Network (GOARN) Program of the World Health Organisation (WHO). B.W. was funded by the China Scholarship Council (CSC), Beijing, China. O.A.A. is funded by the German Academic Exchange Service (DAAD), Bonn, Germany. D.H. is funded by the Claussen-Simon-Stiftung (Claussen-Simon Foundation) “Dissertation Plus” program, Germany. F.A.O and O.A. are funded by a sub-project of the Global Health Protection Programme supported by the Federal Ministry of Health on the basis of a decision by the German Bundestag, the Partnership in Postgraduate Education (PPE), Robert Koch Institute, Berlin, Germany. The content is the responsibility only of the authors and does not represent the views of the CSC, the DAAD, the Claussen-Simon Foundation, and PPE.

Availability of data and materials

All data generated or analysed during this study are included in this published article.

Authors’ contributions

CI and CTB conceptualized the study. BW, OA, FAO, DH performed the experiment and data analysis. DN, ID, OO, UU, NM collected specimens. BW, OA, DH drafted the manuscript. CI and CTB revised the manuscript critically. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable. German public health institute (RKI) is authorized to receive blood residuals from diagnostics for surveillance purposes (Infection Protection Act IfSG §13). All samples analysed were anonymised.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the decision to publish the results.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Division of Viral Gastroenteritis and Hepatitis Pathogens and Enteroviruses, Department of Infectious Diseases, Robert Koch Institute, 13353 Berlin, Germany
(2)
Ladoke Akintola University of Technology, Ogbomoso, Oyo State, P.M.B 4000, Nigeria
(3)
Infectious Hazard Management Department, World Health Organization, Geneva, Switzerland
(4)
Nigeria Centre for Disease Control, Plot 801, Ebitu Ukiwe Street, Jabi, Abuja, Nigeria
(5)
Institute of Tropical Medicine, University of Tübingen, 72074 Tübingen, Germany

References

  1. Yin X, Ying D, Lhomme S, Tang Z, Walker CM, Xia N, Zheng Z, Feng Z. Origin, antigenicity, and function of a secreted form of ORF2 in hepatitis E virus infection. Proc Natl Acad Sci U S A. 2018;115(18):4773–8.PubMedGoogle Scholar
  2. Purdy MA, Harrison TJ, Jameel S, Meng XJ, Okamoto H, Van der Poel WHM, Smith DB, Ictv Report C. ICTV virus taxonomy profile: Hepeviridae. J Gen Virol. 2017;98(11):2645–6.View ArticleGoogle Scholar
  3. Woo PC, Lau SK, Teng JL, Tsang AK, Joseph M, Wong EY, Tang Y, Sivakumar S, Xie J, Bai R, et al. New hepatitis E virus genotype in camels, the Middle East. Emerg Infect Dis. 2014;20(6):1044–8.View ArticleGoogle Scholar
  4. Lee GH, Tan BH, Teo EC, Lim SG, Dan YY, Wee A, Aw PP, Zhu Y, Hibberd ML, Tan CK, et al. Chronic infection with camelid hepatitis E virus in a liver transplant recipient who regularly consumes camel meat and milk. Gastroenterology. 2016;150(2):355–7.View ArticleGoogle Scholar
  5. Wedemeyer H, Pischke S, Manns MP. Pathogenesis and treatment of hepatitis E virus infection. Gastroenterology. 2012;142(6):1388–97.View ArticleGoogle Scholar
  6. Huang CC, Nguyen D, Fernandez J, Yun KY, Fry KE, Bradley DW, Tam AW, Reyes GR. Molecular cloning and sequencing of the Mexico isolate of hepatitis E virus (HEV). Virology. 1992;191(2):550–8.View ArticleGoogle Scholar
  7. Kaiser M, Kamili S, Hayden T, Blumel J, Baylis SA. Genome sequence of a genotype 2 hepatitis E virus World Health Organization reference strain. Genome Announc. 2017;5:e01664–16.View ArticleGoogle Scholar
  8. Purdy MA, Smith DB, Simmonds P, Emerson SU, Harrison T, Meng XJ, Okamoto H, Van der Poel WH, Jameel S. New classification scheme for Hepeviridae. ICTV taxonomic proposal 2014.008a-hV.A.v6.Hepeviridae (approved); 2014. p. 1–15. https://talk.ictvonline.org//taxonomy/.
  9. Bradley DW, Balayan MS. Enterically transmitted non-A, non-B hepatitis: etiology of disease and laboratory studies in nonhuman primates. In: Zuckerman AJ, editor. Viral hepatitis and liver disease. New York: Alan R. Liss, Inc.; 1988. p. 138–47.Google Scholar
  10. Ticehurst J. Identification and characterization of hepatitis E virus. In: Hollinger FB, Lemon SM, Margolis H, editors. Viral hepatitis and liver disease. Baltimore: Williams and Wilkins; 1991. p. 501–3.Google Scholar
  11. Buisson Y, Grandadam M, Nicand E, Cheval P, Van Cuyck-gandre H, Innis B, Rehel P, Coursaget P, Teyssou R, Tsarev S. Identification of a novel hepatitis E virus in Nigeria. J Gen Virol. 2000;81:903–9.View ArticleGoogle Scholar
  12. Maila HT, Bowyer SM, Swanepoel R. Identification of a new strain of hepatitis E virus from an outbreak in Namibia in 1995. J Gen Virol. 2004;85:89–95.View ArticleGoogle Scholar
  13. Nicand E, Armstrong GL, Enouf V, Guthmann JP, Guerin JP, Caron M, Nizou JY, Andraghetti R. Genetic heterogeneity of hepatitis E virus in Darfur, Sudan, and neighboring Chad. J Med Virol. 2005;77:519–21.View ArticleGoogle Scholar
  14. Escriba JM, Nakoune E, Recio C, Massamba PM, Matsika-Claquin MD, Goumba C, Rose AM, Nicand E, Garcia E, Leklegban C, Koffi B, Hepatitis E. Central African Republic. Emerg Infect Dis. 2008;14(4):681–3.View ArticleGoogle Scholar
  15. Smith DB, Simmonds P, Izopet J, Oliveira-Filho EF, Ulrich RG, Johne R, Koenig M, Jameel S, Harrison TJ, Meng XJ, et al. Proposed reference sequences for hepatitis E virus subtypes. J Gen Virol. 2016;97(3):537–42.View ArticleGoogle Scholar
  16. Lu L, Li CH, Hagedorn CH. Phylogenetic analysis of global hepatitis E virus sequences: genetic diversity, subtypes and zoonosis. Rev Med Virol. 2006;16:5–36.View ArticleGoogle Scholar
  17. World-Health-Organization: Acute hepatitis E – Nigeria. Disease outbreak news 2017. http://www.who.int/csr/don/12-july-2017-hepatitis-e-nigeria/en/. Accessed 7 Sept 2018, released 12 July 2017.Google Scholar
  18. Wang B, Harms D, Papp CP, Niendorf S, Jacobsen S, Lutgehetmann M, Pischke S, Wedermeyer H, Hofmann J, Bock CT. Comprehensive molecular approach for characterization of hepatitis E virus genotype 3 variants. J Clin Microbiol. 2018;56:e01686–17.PubMedGoogle Scholar
  19. Wang B, Yang XL, Li W, Zhu Y, Ge XY, Zhang LB, Zhang YZ, Bock CT, Shi ZL. Detection and genome characterization of four novel bat hepadnaviruses and a hepevirus in China. Virol J. 2017;14:40. https://doi.org/10.1186/s12985-017-0706-8.View ArticlePubMedPubMed CentralGoogle Scholar
  20. Elduma AH, Zein MMA, Karlsson M, Elkhidir IME, Norder H. A single lineage of hepatitis E virus causes both outbreaks and sporadic hepatitis in Sudan. Viruses-Basel. 2016;8(10):E273.View ArticleGoogle Scholar

Copyright

© The Author(s). 2018

Advertisement