Skip to main content

Advertisement

Table 1 Primers used for HEV quantification, genotyping, and complete genome sequencing

From: A new hepatitis E virus genotype 2 strain identified from an outbreak in Nigeria, 2017

Primera Sequence (5′-3′) Locationb Use Reference
HEV-07_f GGTGGTTTCTGGGGTGAC 5261–5278 HEV-1 to HEV-4 quantification [18]
HEV-TM3_f FAM-TGATTCTCAGCCCTTCGC-MGB 5284–5301
HEV-08_r AGGGGTTGGTTGGATGAA 5330–5313
HEV-38_f GARGCYATGGTBGAGAARG 4084–4102 HEV-1 to HEV-4 genotyping in ORF1 [18]
HEV-39_r GCCATRTTCCARACRGTRTTCC 4622–4601
HEV-37_f GGTTYCGYGCYATTGARAARG 4277–4297
HEV-27_r TCRCCRGARTGYTTCTTCC 4583–4565
HEV-30_f CCGACAGAATTRATTTCGTCGG 6296–6317 HEV-1 to HEV-4 genotyping in ORF2
HEV-32_f GTCTCRGCCAATGGCGAGCCRRC 6350–6372
HEV-31_r GTYTTRGARTACTGCTGR 6750–6733
HEV-266_f GCARGCTGCTCTRGCWGCGGC 78–98 HEV-2 complete genome sequencing This study
HEV-274_f TGGTGGTTAGGCCTTTTCTCTC 122–143
HEV-275_f CCGATCCAGCGTGTCATACATA 223–244
HEV-267_r GGRGCWGWRTACCARCGCTG 392–373
HEV-268_f AYCTYCGYGGYATTAGCTAYAAGG 1055–1078
HEV-276_r CGTTGATGGCAAATTGTGAGGT 1178–1157
HEV-277_f ATCTCTCGTCTCTACAGCTGGT 1246–1267
HEV-278_f GGGCCGTCAGTTGCAATTTTAT 1299–1320
HEV-283_f GTAGCTGCCGGACTATTGCT 1397–1416
HEV-270_r ARCCACYKCATAAARCARC 1457–1439
HEV-284_f ACCAGGGCCATGACAATGAG 1508–1527
HEV-285_r GAGGCCTGGTCAGCAACTAG 2186–2164
HEV-271_f AACCCMAAGAGGCUYGAGGC 2620–2639
HEV-272_f GCCTGGGARCGKAAYCAYCG 2734–2753
HEV-279_f TGTTCAACGTAGGATGATCCGG 2833–2812
HEV-280_f TTTGAGCATACTGGTCTGGTCC 3220–3241
HEV-273_r CARCGRUGKGURACAUGCCACC 3296–3275
HEV-235_r CYGCCTGGGTGAACACTAG 3421–3403
HEV-265_f ATGGGGACGCCTATGATGAATC 4337–4358
HEV-282_r TTCTGGGTCGAGTCAAACTCAG 4439–4418
HEV-281_r CACTCCTCCATAATAGCGCACT 4481–4460
HEV-286_f TTCTGCTGTTGCTCCTCCTG 5169–5188
HEV-301_f AGACGTCTGGTGTTGCTGAG 5937–5956
HEV-288_r TTTACTGTCGGCTCGGCATT 6384–6365
HEV-287_r GCTGGGCATTCTCCACAGAT 6413–6394
HEV-233_f GCCTSTTTTGTGATGCGCG 6755–6773
  1. aForward primer designations end with _f; reverse primer designations end with _r
  2. bNumbering is according the HEV prototype strain Burma (GenBank accession No. M73218)