Skip to content

Advertisement

Virology Journal

Research
Open Access

Recombinant expression of beak and feather disease virus capsid protein and assembly of virus-like particles in Nicotiana benthamiana

Virology Journal201714:174

https://doi.org/10.1186/s12985-017-0847-9

©  The Author(s). 2017

Received: 5 April 2017

Accepted: 5 September 2017

Published: 11 September 2017

Abstract

Background

Beak and feather disease virus (BFDV) is an important disease causing agent affecting psittacines. BFDV is highly infectious and can present as acute, chronic or subclinical disease. The virus causes immunodeficiency and is often associated with secondary infections. No commercial vaccine is available and yields of recombinant BFDV capsid protein (CP) expressed in insect cells and bacteria are yet to be seen as commercially viable, although both systems produced BFDV CP that could successfully assemble into virus-like particles (VLPs). Plants as expression systems are increasingly becoming favourable for the production of region-specific and niche market products. The aim of this study was to investigate the formation and potential for purification of BFDV VLPs in Nicotiana benthamiana.

Methods

The BFDV CP was transiently expressed in N. benthamiana using an Agrobacterium-mediated system and plant expression vectors that included a bean yellow dwarf virus (BeYDV)-based replicating DNA vector. Plant-produced BFDV CP was detected using immunoblotting. VLPs were purified using sucrose cushion and CsCl density gradient centrifugation and visualised using transmission electron microscopy.

Results

In this study we demonstrate that the BFDV CP can be successfully expressed in N. benthamiana, albeit at relatively low yield. Using a purification strategy based on centrifugation we demonstrated that the expressed CP can self-assemble into VLPs that can be detected using electron microscopy. These plant-produced BFDV VLPs resemble those produced in established recombinant expression systems and infectious virions. It is possible that the VLPs are spontaneously incorporating amplicon DNA produced from the replicating BeYDV plant vector.

Conclusions

This is the first report of plant-made full-length BFDV CP assembling into VLPs. The putative pseudovirions could be used to further the efficacy of vaccines against BFDV.

Keywords

Plant-made pharmaceuticalBeak and feather disease virusVirus-like particleCircovirusSubunit vaccine

Background

Beak and feather disease virus (BFDV; family Circoviridae, genus Circovirus) is one of the most common disease agents to infect psittacines [1]. The virus infects both wild and captive birds, and has been detected in at least 10% of psittacine species [2–4]. It is the causative agent of psittacine beak and feather disease (PBFD), which can present in three forms. The acute form of the disease has a high mortality rate and is mainly seen in young and neonatal birds [5, 6]. By far the most reported form of the disease is the chronic form, which primarily affects adult birds [7]. Symptoms of chronic disease are the characteristic beak and feather abnormalities associated with PBFD [8]. Birds that are infected with BFDV become immunocompromised, which is the primary cause of chronic infection and persistent excretion of the virus in diseased birds [9, 10]. The third form of the disease is subclinical infection: this form presents the greatest risk for disease spread, as the infected birds continue to shed virus at low concentrations and show no symptoms of infection [11, 12].

A commercial vaccine for BFDV is currently unavailable, and treatment of PBFD is principally palliative and supportive [13–15]. Eradication of the disease is unlikely due to the prevalence of infection and the stability of the virus [16]. A vaccine against BFDV would therefore be desirable, especially due to the presence of subclinical infections that may complicate biocontrol efforts, and since the disease progression varies. The likelihood that a single-strain vaccine would be successful is high, due to the absence of obvious serotypes which indicates conservation of major epitopes between isolates: there is therefore a high probability of cross-isolate protection [17, 18].

The virions of BFDV consist of icosahedral capsids, containing a 2-kb circular ssDNA genome that encodes two genes: these are the capsid gene (cp), which produces the CP, and the replication associated protein (rep), which produces Rep [19–21]. The literature reports the size of the virion to be between 14 and 20 nm in diameter, with the smallest reported size being 10 nm and the largest being 22 nm (Fig. 1). The range of virion sizes appeared to be independent of whether uranyl acetate or phosphotungstic acid was used during the staining procedure. A three dimensional structure determined by cryoelectron microscopy, however, gives a size of 20.5 nm [20]. The most recent analysis of particle size using electron and atomic force microscopy indicates that the CP can form two distinct assemblies with sizes of 10 nm and 17 nm and in addition this could possibly explain the range of reported values that have been described [22]. The virion is extremely stable in the environment, and horizontal transmission through ingestion of contaminated material is seen as the primary route of infection [16, 23]. The persistence of virus outside of the host and a dearth of available treatments have resulted in considerable research towards developing a vaccine against BFDV.
Figure 1
Fig. 1

Summary of the BFDV virion size as reported by various authors. Sizes were determined from electron micrographs of particles stained with either uranyl acetate (black) or phosphotungstic acid (grey) Trinkaus, et al. [59], Ritchie, et al. [8], Kock, et al. [60], Ritchie, et al. [49], Ritchie, et al. [49], Greenacre, et al. [61], Sanada, et al. [62], Todd, et al. [55], McOrist, et al. [63], Jacobson, et al. [64], Todd, et al. [55], Wylie and Pass [65], Crowther, et al. [20], Pass and Perry [66]

Initial vaccine research centred on inactivated virus vaccines derived from whole tissue of infected birds, purified from feathers or internal organs [12]. This was problematic, however, as production of purified virus was reliant on sourcing infected birds, which has ethical implications and can be severely limiting in terms of availability of harvestable tissue [10]. Furthermore, problems arising from incomplete inactivation of the purified virus have made an inactivated BFDV vaccine an unattractive option [24]. The virus has not as yet been propagated in tissue culture; therefore, the application of recombinant DNA technologies has been viewed as an alternative to infected whole tissue as a source of virus [25].

Recent work towards expression of recombinant BFDV CP shows great promise, with the CP having been successfully expressed using a number of expression platforms, including bacterial and yeast fermentation, insect cell culture and plants [15, 26–29]. Tissue culture technology has also been applied in the expression of other circovirus CPs, such as porcine circovirus (PCV) and goose circovirus (GoCV) [30, 31]. Use of recombinant PCV CP as a vaccine has been shown to result in a humoral response that can produce sterilising immunity that blocks effective virus infection of the host [32, 33]. Limited studies have been conducted on recombinant BFDV CP; however, Bonne, et al. [10] reported that vaccination with insect cell-produced CP failed to elicit sterilising immunity, and instead resulted in a decrease in viraemia, replication and virus shedding. This research indicates that recombinant BFDV CP could be used to effect a response in the psittacine immune system, but that further optimisation of the dosage would be required to improve the strength of the immune response.

One important area of focus for recombinant viral vaccine research has been in the production of virus-like particles (VLPs). These lack viral nucleic acids and are therefore non-infectious, while retaining the same structural characteristics of the infectious virion [34]. VLPs are highly immunogenic and stimulate both the humoral and cellular response pathways even in the absence of adjuvants, and have been successfully applied in humans – both the hepatitis B and human papillomavirus vaccines are VLP-based – as well as in humans and poultry, against influenza [35–39]. The BFDV virion has a T = 1 symmetry and is assembled from 60 CP subunits that are arranged into 12 pentamer units [20]. The virion of circoviruses is comprised of repeats of a single protein, making it an attractive target for investigation of the production of VLPs – and these have in fact been demonstrated for PCV and demonstrated for bacterial and insect cell-produced BFDV CPs [22, 40–42].

Recombinant BFDV CP expressed in insect cell culture spontaneously assembles into particles ranging in size from 16 to 22 nm in diameter, which falls within the size range reported for infectious virions (10–22 nm in diameter) [41]. Attempts to produced BFDV VLPs using other recombinant systems have been mixed: for example, expression of the full-length BFDV CP using bacterial fermentation resulted in insoluble protein and low yields [15, 27]. Although the expression of a truncated version was successful in increasing yields, this may hinder the assembly of intact VLPs [27]. Sarker, et al. [29] have been able to successfully express the BFDV CP and form VLPs in E. coli with the yield an order of magnitude greater than reported in previous studies. Plant-based expression in N. benthamiana of BFDV CP by Duvenage, et al. [26] included a C-terminal-fused 140 or 255 residue elastin-like polypeptide to improve protein yield and ease of purification. The fusion of the BFDV CP to the peptide tag would potentially affect the ability of the CP to assemble into VLPs, and assembly of the plant-expressed BFDV CP into VLPs was not assessed.

In summary, the development of a vaccine against BFDV has moved away from inactivated virus towards the recombinant expression and purification of BFDV CP. This has been shown to successfully produce a humoral response in vaccinated birds. Insect cell and bacterial fermentation-derived BFDV CP have been reported to assemble into VLPs, but this has yet to be shown for plant systems. The aim of this study, therefore, was to investigate the formation and potential for purification of BFDV VLPs in N. benthamiana, through the transient expression of the BFDV CP using, among others, a bean yellow dwarf virus (BeYDV)-based replicating DNA vector.

Methods

Molecular cloning

The BFDV cp sequence from isolate BKS1ZA_84 (GenBank accession number GQ165756), isolated by Varsani, et al. [43] from a Budgerigar, was synthesised without codon optimisation by Geneart (Germany). The plant expression vectors used in this study were based on the pTRA binary Agrobacterium tumefaciens plant expression vector suite which was provided by Prof. Rainer Fischer of the Fraunhofer Institute for Molecular Biology and Applied Ecology in Germany [44]. The vector suite consists of three plant expression vectors targeting protein expression to different locations within the cell: pTRAc (cytoplasm), pTRAkc-ERH (endoplasmic reticulum retained) and pTRAkc-rbcs1-cTP (stromal compartment of the chloroplast) (Fig. 2). Removal of the SEKDEL-encoding sequence for pTRAkc-ERH produces pTRAkc-AH, which allows for the secretion of the recombinant protein to the apoplast. A fourth plant expression vector that was used for the expression of the BFDV CP was pRIC 3.0 (Fig. 2). This vector incorporates sequences of the single-stranded circular DNA genome of BeYDV that allow for vector replication in planta [45]. PCR amplification was used to modify the terminal ends of the BFDV cp (Table 1), including a C-terminal histidine tag sequence and the introduction of restriction sites to generate a set of non-replicating and replicating constructs with different localisation signals (Fig. 3).
Figure 2
Fig. 2

Agrobacterium pTRA plant expression vectors: pTRAc (a), pTRAkc-ERH (b), pTRAkc-rbcs1-cTP (c) and pRIC 3.0 (d). LB and RB, left and right borders for T-DNA integration; SAR, scaffold attachment region of the tobacco Rb7 gene; P35SS, CaMV 35S promoter with duplicated transcriptional enhancer; CHS, chalcone synthase 5′ untranslated region; pA35S, CaMV 35S polyadenylation signal; RK2 ori, origin of replication for A. tumefaciens; bla, ampicillin/carbenicillin-resistance bla gene; ColE1 ori, origin of replication for E. coli; LPH, signal peptide sequence from the murine mAb24 heavy chain; 6xHis, 6 His tag sequence; SEKDEL, ER-retention signal sequence; rbcs1-cTP, chloroplast-transit peptide sequence of a Rubisco small-subunit gene (rbcS1) from S. tuberosum; npt II, kanamycin-resistance npt II gene; Pnos and pAnos, promoter and polyadenylation signal of the nopaline synthase gene; LIR, BeYDV long intergenic region; rep/repA, BeYDV rep/repA gene; SIR, BeYDV short intergenic region

Table 1

Primers for PCR amplification used during molecular cloning

Product

Sense primer

Antisense primer

Description

Size (bp)

Sequence (5′ - 3′)

Cloning site

Sequence (5′ - 3′)

Cloning site

BFDV BKS1ZA_84 cp 6xHis

 

GTAACGCGTTAGGTACATGTGGGGCACCTCTAAC

AflIII/MluI

GTGATGGTGATGCCCTTCAGTTCTGGGATTATTGG

 

796

GTAACGCGTTAGGTACATGTGGGGCACCTCTAAC

AflIII/MluI

CATCTCGAGCTAGTGATGGTGATGGTGATGCCCTTC

XhoI

rbcs1-cTP BFDV BKS1ZA_84 cp 6xHis

959

GGACCATGGCTTCCTCTGTTATTTCCTC

NcoI

CATCTCGAGCTAGTGATGGTGATGGTGATGCCCTTC

XhoI

BFDV BKS1ZA_84 cp 6xHis SEKDEL

 

GTAACGCGTTAGGTACATGTGGGGCACCTCTAAC

AflIII/MluI

CTCATCTTTCTCAGAGTGATGGTGATGGTGATGCC

 

814

GTAACGCGTTAGGTACATGTGGGGCACCTCTAAC

AflIII/MluI

CCTCTCGAGCTAGAGCTCATCTTTCTCAGAGTGAT

XhoI

LPH BFDV BKS1ZA_84 cp 6xHis SEKDEL

860

GGACCATGGAGTGGAGCTGGATCTTC

NcoI

CCTCTCGAGCTAGAGCTCATCTTTCTCAGAGTGAT

XhoI

LPH BFDV BKS1ZA_84 cp 6xHis

840

GGACCATGGAGTGGAGCTGGATCTTC

NcoI

CATCTCGAGCTAGTGATGGTGATGGTGATGCCCTTC

XhoI

Underlined sequence indicates restriction enzyme sites

Figure 3
Fig. 3

Plant expression and localisation cassettes and Agrobacterium plant expression vectors used in this study. BFDV cp (purple); P35SS, CaMV 35S promoter with duplicated transcriptional enhancer; CHS, chalcone synthase 5′ untranslated region; pA35S, CaMV 35S polyadenylation signal; 6xHis, 6 His tag sequence; LPH, signal peptide sequence from the murine mAb24 heavy chain; SEKDEL, ER-retention signal sequence; rbcs1-cTP, chloroplast-transit peptide sequence of a Rubisco small-subunit gene (rbcS1) from S. tuberosum

A. tumefaciens-mediated transient expression

The A. tumefaciens GV3101::pMP90RK cells were electroporated using 40–400 ng of recombinant plasmid as described by Maclean, et al. [44]. Recombinant clones were selected using agar plates containing kanamycin (30 μg/mL), rifampicin (50 μg/mL) and carbenicillin (50 μg/mL) and incubated at 27° C.

For infiltration, recombinant A. tumefaciens GV3101::pMP90RK were grown up overnight at 27° C with agitation in induction medium supplemented with kanamycin (30 μg/mL), rifampicin (50 μg/mL) and carbenicillin (50 μg/mL) [45]. The strain LBA4404 containing pBIN-NSs, provided by Marcel Prins from the Laboratory of Virology, Wageningen in the Netherlands, was supplemented with kanamycin (30 μg/mL), rifampicin (50 μg/mL) and 2 mM MgSO4. The addition of MgSO4 was to prevent cell clumping during incubation [44]. The NSs protein has been shown to suppress post-transcriptional gene silencing in plants, leading to an increase in transient protein expression [46]. Cells were harvested by centrifugation at 4000 g for 10 min, and resuspended in infiltration medium [45]. The suspensions were diluted to the required absorbance (OD600), for expression optimisation studies a range of OD600 values were tested, using an Ultrospec™ 10 Cell density meter (Amersham Biosciences, United Kingdom) and incubated at 22° C for 2 h. The A. tumefaciens GV3101::pMP90RK suspensions of each expression construct were co-infiltrated with strain LBA4404 containing pBIN-NSs into 6-week-old N. benthamiana plants by injecting the suspension into the abaxial spaces using a needleless 1 mL syringe. The plants were maintained in a greenhouse under a 16 h light and 8 h dark photoperiod at light intensity of 60–80 μE/m2/s and 22° C.

Vacuum infiltration of A. tumefaciens into N. benthamiana was performed as described by Maclean, et al. [44], with the following modifications. The Agrobacterium strains were combined in infiltration medium for a final OD600 of 1.00 for strain GV3101::pMP90RK and 0.25 for strain LBA4404 making a total OD600 of 1.25. The 6-week-old N. benthamiana plants were prepared for inversion into infiltration medium by sealing the base of the plant through the use of a 130 × 130 mm acrylic sheet that contained a 10 mm channel to the centre to allow for the plant stem to be inserted (Fig. 4). This prevented soil from falling into the infiltration medium while the plant was inverted and leaves and stem submerged.
Figure 4
Fig. 4

Acrylic seal used to enclose soil during vacuum infiltration of N. benthamiana. The acrylic  sheet (130 × 130 mm) prevented soil from upturned plants from falling into the infiltration medium

Plants were submerged into the bacterial suspension and subjected to a vacuum of −90 kPa for 5–10 min, with occasional agitation to release trapped air bubbles. The vacuum was released rapidly (approximately 10 kPa/s). In addition, a recombinant expression control, using strain LBA4044 only, was vacuum infiltrated into plants. The plants were grown as described above.

The following controls were included: plant leaf tissue only, plant leaf tissue infiltrated with infiltration medium only, plant leaf tissue infiltrated with strain LBA4404 only, plant leaf tissue infiltrated with strain GV3101::pMP90RK only and plant leaf tissue co-infiltrated with both strains.

Protein extraction and western blot analysis

For expression optimisation studies leaf discs were harvested at 1, 3, 5 and 7 days post infiltration (DPI). The plant material was prepared into a fine powder using a micro-pestle and liquid nitrogen. One hundred microlitres of extraction buffer (50 mM Tris, 100 mM NaCl, 10% glycerol and 1 mM dithiothreitol at pH 7.5) per leaf disc was added and the leaf material was vortexed. The suspension of leaf tissue was clarified by centrifugation at 1500 g for 3 min and the supernatant representing the crude leaf extract was collected for further analysis. These were incubated at 90° C for 10 min in sample application buffer prepared for analysis by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) [47].

The proteins were resolved on 10% SDS polyacrylamide gels and an equal volume of crude plant extract or equal amount of total soluble protein (TSP) were loaded into each lane. After gel electrophoresis the proteins were transferred onto nitrocellulose membranes at 15 V for 1 h using a Trans-blot®SD semi-dry transfer cell (Bio-Rad, CA, United States of America). The membranes were probed overnight at 4° C with 1:2000 anti-His tag mouse IgG antibody (AbD Serotec, NC, United States of America), and subsequently incubated in a 1:10,000 dilution of anti-mouse IgG (whole molecule) alkaline phosphatase antibody produced in goat affinity isolated antibody (Sigma-Aldrich). Membranes incubated in secondary antibody were washed four times with 1× PBST, with 15 min for each wash. Detection was performed with 5-bromo, 4-chloro, 3-indolylphosphate (BCIP) and nitroblue tetrazolium (NBT) phosphatase substrate (KPL, MD, United States of America).

Vacuum infiltrated plant leaves were harvested on day 3 post-infiltration and approximately 25 g of leaf tissue was used for the extraction of expressed recombinant BFDV CP. Leaves were rinsed in water to remove soil particulates and dried with paper towel to remove excess water, after which the plant material was ground into a fine powder in liquid nitrogen using a mortar and pestle. The plant material was then combined with PBS containing cOmplete™ Mini, EDTA-free protease inhibitor (Roche) using a ratio of 1:2 (w/v) of plant material to extraction buffer. PBS has previously been used as a buffer for the extraction of BFDV virions from whole tissue of diseased psittacines [48]. The mixture was then homogenised for 5 min at 10000 rpm and 4° C using a T 25 digital ULTRA-TURRAX® (IKA® Works Inc., NC, United States of America). The homogenate was centrifuged at 4000 g for 10 min at 4° C using a JA-14 rotor (Beckman Coulter, CA, United States of America). The supernatant was then filtered through two layers of Miracloth (Merck, Germany) in preparation for sucrose cushion centrifugation.

Sucrose cushion centrifugation

Sucrose cushion centrifugation was based on the technique for purification PCV-2 capsid particles described by Wu, et al. [42]. A 40% w/v sucrose solution (470.6 mg/mL of solution) was prepared in water and confirmed using a R5000 hand refractometer (Atago, Japan). A 2 mL 40% sucrose cushion was prepared in 5 mL Ultra-Clear™ centrifugation tubes (Beckman Coulter) and layered with supernatant derived from the slow speed centrifugation step. The tubes were centrifuged in a SW 55 Ti rotor (Beckman Coulter) at 40500 rpm (RCFmax ≈ 200,000 g) for 6 h at 4° C. The pellet was resuspended in 500 μL of PBS and further analysed by transmission electron microscopy (TEM).

Transmission electron microscopy

Analysis of BFDV CP particle assembly was done using TEM. Copper grids (mesh size 200) were made hydrophilic by glow discharging at 25 mA for 30 s using a Model 900 SmartSet Cold Stage Controller (Electron Microscopy Sciences, PA, United States of America). The grids were then placed on a 1:100 dilution of the samples for 5 min and then washed three times in sterile water. The grids were negatively stained on uranyl acetate for 10 s and again for a further 20 s and viewed using a Tecnai™ F20 Scanning Transmission Electron Microscope (FEI, OR, United States of America).

CsCl density gradient centrifugation

CsCl density gradient centrifugation was performed based on a protocol modified from Ritchie, et al. [49]. Leaves containing expressed recombinant BFDV CP were extracted as described above using a 50 mM Tris at pH 7.6 buffer at a ratio of 3:1 (v/w) buffer to plant material. The sample together with a 5 mL sucrose cushion (45% w/v sucrose solution; 541.1 mg/mL of solution) was centrifuged in a SW 32 Ti rotor (Beckman Coulter) at 32000 rpm (RCFmax ≈ 175,000 g) for 2 h at 4° C. The resulting pellet was used for CsCl density gradient fractionation.

The pellets were resuspended in Tris buffer containing CsCl at a density of 1.406 g/cm3. CsCl density was confirmed using a R5000 hand refractometer (Atago). The resuspended pellets were centrifuged using a SW 55 Ti rotor (Beckman Coulter) at 48000 rpm (RCFmax ≈ 280,000 g) for 20 h at 20° C. The CsCl gradient was fractionated using a Foxy® Jr. Fraction Collector (Teledyne Isco, NE, United States of America). The refractive index for each fraction was determined using the refractometer; 10 μL of each fraction was spotted onto nitrocellulose membrane and western blot analysis was performed as described above. The BFDV CP present on the nitrocellulose membrane was then quantified using a Syngene Gene Genius imaging system and GeneTools software (Synoptics Inc., United Kingdom). In addition to quantifying the BFDV CP in each fraction, a ND-1000 Spectrophotometer (NanoDrop®, DE, United States of America) was used to determine the TSP (Protein A280 module) and total DNA (Nucleic acid module).

Fractions containing the greatest concentration of BFDV CP were pooled and dialysed using dialysis tubing cellulose membrane (Sigma-Aldrich) against 50 mM Tris at pH 7.6. Dialysed pooled fractions were analysed using western blotting as described above.

Results

Optimisation of BFDV CP expression in N. benthamiana

To determine the best conditions for expression, various densities of Agrobacterium suspensions were tested by plant syringe infiltration, and leaves were harvested on days 1, 3, 5 and 7. The optimum optical density for Agrobacterium suspension infiltration was determined to be 0.50 and 1.00 for the expression of BFDV CP and 0.25 for the expression of the silencing suppressor NSs, while the optimum day post-infiltration to harvest was determined by western blotting to be day 3 (data not shown). The effect of targeting the full-length BFDV CP to different organelles - chloroplast and ER, and secretion to the apoplast - was assessed together with gene amplification due to the replicating expression vector.

The CP was expressed by each plant expression vector (Fig. 5a). Additional proteins with higher molecular weights than the CP were detected in the SDS-PAG electropherograms. The cytoplasm was the most favourable location for accumulation, followed by the chloroplast and the ER, while accumulation of CP in the apoplast was the lowest. Gene amplification had a mixed effect on expression: accumulation in the cytoplasm and chloroplasts appeared to be improved; however, accumulation in the ER decreased, and there was no change when the CP was secreted to the apoplast. Overall, expression in the cytoplasm with gene amplification was determined to be the most favourable.
Figure 5
Fig. 5

Western blot analysis of BFDV CP expression. a Analysis of the effect of targeted BFDV CP localisation and BFDV cp gene amplification on expression. Protein was extracted on day 3 from N. benthamiana leaves. Expression of the CP in the cytoplasm (30.1 kDa), the chloroplast (36.0 kDa), ER (33.0 kDa) and secretion into the apoplast (32.3 kDa). Expression in the presence (+) or absence (−) DNA amplification of the cp was assessed in all cases. An equal amount of TSP was loaded into each lane and the CP was detected using anti-histidine antibody. M – prestained protein marker, P – positive control. b Analysis of BFDV CP expression comparing syringe versus vacuum infiltration of Agrobacterium. Negative controls were non-infiltrated plant leaves, leaves infiltrated with medium and NSs only. The presence (+) or absence (−) of each component is specified. TSP was extracted from leaf tissue harvested on day 4 post-infiltration. An equal volume of each sample was loaded into the lanes

Vacuum infiltration of N. benthamiana for the expression of BFDV CP

A comparison was made between the two methods of infiltration using the replicating pRIC 3.0 vector without a localisation signal (cytoplasm, Fig. 5b): the 30.1 kDa CP was successfully expressed in N. benthamiana using both methods. The silencing suppressor evidently improved expression of the CP, as an increase in band intensity was apparent for the CP co-expressed with NSs.

The pellet deriving from the sucrose cushion centrifugation of clarified plant extract was resuspended and analysed by TEM (Fig. 6). This analysis showed regular particles ranging between 13 and 23 nm in diameter in the pellet deriving from leaf tissue expressing the BFDV CP together with the silencing suppressor NSs (Fig. 6a). The predominant size detected was ~17 nm in diameter. Analysis of the pellet from leaf tissue expressing the silencing suppressor NSs only showed nothing consistent with VLPs (Fig. 6b).
Figure 6
Fig. 6

Transmission electron micrographs of the partially purified BFDV VLPs (indicated by white arrows) after sucrose cushion centrifugation. a Resuspended pellet from leaf tissue expressing the BFDV CP with C-terminal histidine tag together with the silencing suppressor NSs. b Resuspended pellet from leaf tissue expressing only the silencing suppressor NSs which served as a negative control

The BFDV CP/NSs co-expression and the NSs control pelleted material were further analysed by CsCl density gradient centrifugation. Fractions of the CsCl density gradients were collected for western blotting, and spectrophotometric analysis (Fig. 7): the fractions represent a CsCl density gradient that ranged from 1.29 g/cm3 to 1.58 g/cm3. Dot blot analysis using anti-histidine antibody on gradient fractions indicated a peak in staining intensity at fraction 6 for samples containing the BFDV CP co-expressed with the NSs silencing suppressor, and a shoulder peak in fraction 8 (Fig. 7a). These peaks were absent in the NSs-only samples. The peak fraction 6 for the CP/NSs sample corresponded to a CsCl density of 1.38 g/cm3. The shoulder peak (fraction 8) had a CsCl density of 1.34 g/cm3. Fractions 5–7 of for each density gradient were pooled, dialysed and analysed by Coomassie blue staining and western blotting of SDS-PAGE gels (Fig. 7b). The BFDV CP was undetectable when gels were stained with Coomassie blue (data not shown). However, bands corresponding to the histidine-tagged 30.1 kDa CP and a protein of approximately 60 kDa were detected in the CP/NSs sample, while no histidine-tagged proteins were detected for the pooled fractions of the NSs silencing suppressor expressed on its own.
Figure 7
Fig. 7

CsCl density gradient centrifugation profile of BFDV CP. a The CsCl density (♦) and relative intensity of histidine tagged protein as determined by dot-blot from leaf tissue co-expressing the BFDV CP and NSs silencing suppressor (■) or the NSs silencing suppressor alone (□). b Western blot analysis of pooled fractions 5–7 after dialysis. M – Prestained protein marker, 1 – NSs control, 2 – BFDV CP and NSs. An equal volume of each sample was loaded into the lanes and the CP was detected using anti-histidine

Further CsCl density gradient fraction analysis included spectrophotometry for protein (280 nm) and DNA (260 nm) concentrations. Three BFDV CP/NSs gradients were analysed (Fig. 8) by dot blot analysis using anti-histidine antibody compared to CsCl density, and by TSP and total DNA concentration determination. The CsCl density gradient ranged from 1.29 g/cm3 to 1.55 g/cm3. Again, a dot blot intensity peak was observed between fraction 5 and 6, corresponding to CsCl densities between 1.41 g/cm3 and 1.44 g/cm3 (Fig. 8a). The shoulder peak seen in the previous results was absent. A peak in TSP of 0.92 mg/mL was seen in fraction 5 (Fig. 8b). A second smaller peak for TSP was observed in fraction 9 (CsCl density of 1.34 g/cm3), while a final peak was present at a density of 1.55 g/cm3. Similar peaks were detected for total DNA concentration (Fig. 8c).
Figure 8
Fig. 8

CsCl density gradient centrifugation profiles of BFDV CP, protein and DNA concentration. Comparison of relative intensity of histidine tagged protein as determined by dot-blot from leaf tissue co-expressing the BFDV CP and NSs silencing suppressor (■) with a CsCl density (♦), b TSP concentration (□) and c total DNA concentration (□)

Discussion

The recombinant expression of BFDV CP in N. benthamiana was optimised by determining the optimum optical density of Agrobacterium at infiltration, the optimum day post infiltration for leaf harvesting, and the most favourable localisation of BFDV CP inside various cellular compartments (Fig. 5a). Localisation in the cytoplasm led to the greatest accumulation of CP, on day 3 PI, when compared to chloroplast, apoplast and ER localisation. This corresponds well with what happens with the CP during viral infection, when CP expressed in the cytoplasm is transported into the nucleus by means of the nuclear localisation signal (NLS) encoded in its sequence [27]. While nuclear localisation was not investigated here, it is possible that presence of the NLS may negatively affect targeting to other cellular compartments: the NLSs are located in the N-terminal region and could compete effectively with other N-terminal signal tags. For example, chloroplast signal-tagging of the CP in this work resulted in the presence of an additional protein band of higher molecular weight: this could result from the CP being transported into the nucleus before the signal tag could be cleaved and CP deposited into the chloroplast. In order to confirm this, fluorescently labelled BFDV CP could be used together with an inverted epifluorescence microscope to trace the localisation of the protein in the plant cell as has been demonstrated using insect tissue culture by Heath, et al. [27]. Targeting the CP to the ER, with or without inclusion of the ER retention SEKDEL sequence, resulted in a reduction in CP accumulation. It could be suggested that retention in the ER resulted in the CP being diverted to proteolytic vesicles, which would reduce the overall accumulation of CP in the plant cell. Alternatively, secretion to the apoplast could also result in degradation by abundant proteases in this compartment. While accumulation in the cytoplasm was satisfactory, an additional cellular compartment that could be investigated is the vacuole: Thomas and Walmsley [50] reported the accumulation of human epidermal growth factor was greatest when targeted to the vacuole, when compared to the ER and apoplastic space.

An increase in gene copy number had a variable effect on protein accumulation, dependent on the protein localisation. Gene amplification increased the overall protein accumulation in the cytoplasm and chloroplast, while a decrease/no effect in accumulation was observed in the apoplastic space and ER. As has been previously reported, an increase in gene copy number by means of gene amplification based on BeYDV rolling circle replication (RCR) could result in up to three orders of magnitude increase in gene copy number, with only a marginal increase in protein accumulation [45]. This could be as a result of diversion of cell resources away from transcription and protein translation to DNA replication. Analysis of mRNA transcription from a non-replicating plant expression vector has shown transcript levels to peak at three orders of magnitude higher [51]. Gene amplification would therefore probably compete with transcription for cell resources. A solution to this would be to control the level of gene amplification to much lower levels.

Although the various optimisations increased the expression level of BFDV CP, the protein was undetectable by SDS-PAGE when stained with Coomassie blue. Coomassie blue dyes can detect as few as 25 ng per band for most proteins: this would indicate that the concentration of BFDV CP was below 625 ng/mL. The BFDV CP would represent less than 0.00025% of TSP, and in terms of overall yield of BFDV CP per gram of fresh weight, this would be less than 5 mg/kg. This is similar to recombinant expression levels seen for plant-produced HIV p17 ⁄ p24 of 5 mg/kg [45, 52], but far lower than the >500 mg/kg achieved for HPV-16 L1 protein using the same vector systems [44, 45]. For plant-produced BFDV to be viable, yields approaching at least 50 mg/kg are required to commercial production, as has been reported for influenza VLPs [53].

Vacuum infiltration resulted in the same level of expression as when Agrobacterium suspensions are infiltrated using a needleless syringe, and as has previously been demonstrated, the co-expression of the silencing suppressor protein NSs results in an increase in BFDV CP accumulation (Fig. 5b). It could be suggested that the larger proteins detected in this study are potentially CP dimers, trimers and tetramers, and that these could potentially be precursors to the pentameric subunits described by Crowther, et al. [20].

TEM analysis of the sucrose cushion pellet revealed negatively stained particles that were circular and featureless (Fig. 6). This description perfectly fits the infectious BFDV particles seen by Crowther, et al. [20]. The plant-produced BFDV particles ranged between 13 and 23 nm in diameter, and were similar to putative BFDV VLPs produced in insect cell cultures, which ranged between 16 and 22 nm diameter [41]. The predominant diameter measured was approximately 17 nm, which falls neatly within the 10–22 nm range reported for infectious virions, and is the same diameter as has been reported for the solved atomic structure of BFDV VLPs [22]. These values are similar to insect cell-produced PCV VLPs that averaged 20 nm in diameter, closely resembling the infectious PCV virion that consists of a 1.7-kb genome encapsidated within a 20.5 nm non-enveloped capsid [20]. The addition of a histidine tag on the C-terminus, used for immunodetection, did not appear to negatively affect particle structure; however, the effect on the antigenicity of the protein would need to be addressed before immunogenicity studies.

Fractionation of CsCl gradients of the pellet produced during sucrose cushion centrifugation produced two peaks of BFDV CP. The major peak occurred at an approximate density of 1.38 g/cm3, while a shoulder peak at 1.34 g/cm3 was also detected (Fig. 7). A similar density of 1.365 g/cm3 has been reported for PCV VLPs produced in Tn5 insect cells [54]. The higher observed density could also be the result of the presence of the C-terminal 6xHis tag. The absence of viral DNA has been seen to affect the density of the VLPs. Infectious BFDV virions purified using CsCl have a density ranging between 1.35–1.378 g/cm3, while intact VLPs range between 1.215–1.325 g/cm3 [41, 48, 55]. A similar decrease in density has been reported for PCV VLPs [40].

To further investigate the purification of BFDV VLPs spectrophotometric analysis of protein and DNA concentrations were performed. The CsCl gradient fractions from material made using the recombinant replicating geminivirus-derived vector revealed coincident peaks corresponding to the protein and DNA (Fig. 8). This suggests that the BFDV CP could be packaging single-stranded amplicon DNA, as the viruses have very similar replication cycles. It could be that the major peak represents VLPs containing plant expression vector replicon DNA generated from RCR, and the shoulder peak could represent empty VLPs. Considering the BeYDV replicon is approximately 3.3-kb it is questionable whether it could be successfully packaged by the BFDV CP. A BeYDV replicon that was similar in size to the 2-kb BFDV genome would be more suitable for encapsidation. Plant viral CPs have been shown to effectively and spontaneously package nucleic acids of mammalian viruses [56]. These pseudovirions have then been shown to release their nucleic acids into the cytoplasm of mammalian cells. This technology has also been used successfully using a plant-produced bamboo mosaic virus particles containing infectious bursal disease virus antigens for the immunisation of chickens [57]. Plant-produced CP derived from circoviruses could similarly be used to package nucleic acids that have been replicated in planta using the BeYDV replication system. These pseudovirions could then potentially be used to create a potent vaccine capable of eliciting a strong humoral and cellular response in the target host. This has previously been demonstrated in our group for plant-made human papillomavirus pseudovirions used in neutralisations assays [58].

Conclusions

In conclusion, BFDV CP has been shown to be successfully expressed in N. benthamiana via syringe or via vacuum infiltration. It has also been shown to self-assemble into VLPs even when fused with a C-terminal histidine tag that can be detected using electron microscopy and purified using CsCl centrifugation. These plant-produced BFDV VLPs resemble those produced in insect cells and infectious virions; however the yield was low, as the CP was undetectable when stained with Coomassie. The detection of VLPs in plants allows for refinement of the purification method, possibly by incorporating knowledge of the sedimentation coefficient determined for PCV and CAV to improve isolation by centrifugation. It is possible that the VLPs are spontaneously incorporating amplicon DNA produced from the replicating BeYDV plant vector. The putative pseudovirions could be used to further the efficacy of vaccines against BFDV.

Abbreviations

BCIP: 

5-bromo, 4-chloro, 3-indolylphosphate

BeYDV: 

bean yellow dwarf virus

BFDV: 

beak and feather disease virus

cp : 

capsid gene

CP: 

capsid protein

DPI: 

days post infiltration

GoCV: 

goose circovirus

NBT: 

nitroblue tetrazolium

PBFD: 

psittacine beak and feather disease

PCV: 

porcine circovirus

rep : 

replication associated protein

SDS-PAGE: 

sodium dodecyl sulphate-polyacrylamide gel electrophoresis

TSP: 

total soluble protein

VLPs: 

virus-like particles

Declarations

Acknowledgements

The authors would like to thank Prof. Rainer Fischer of the Fraunhofer Institute for Molecular Biology and Applied Ecology in Germany for the pTRA vectors, Marcel Prins from the Laboratory of Virology, Wageningen in the Netherlands for providing pBIN-NSs and Dr. Mohammed Jaffer from the EM unit at UCT for help with the microscopy.

Availability of data and material

Not applicable.

Funding

This work was supported by funding from the South African National Research Foundation (NRF) and the University of Cape Town Research Committee (URC). The authors gratefully acknowledge the Poliomyelitis Research Foundation, the Harry Crossley Foundation as well as the NRF for student funding for Guy Regnard. Opinions expressed and conclusions arrived at, are those of the authors and are not necessarily attributed to the NRF.

Authors’ contributions

IIH, GLR and EPR conceived and designed the experiments. GLR performed the experiments. IIH, GLR and EPR analyzed the data. IIH and EPR contributed reagents/materials/analysis tools. IIH, GLR and EPR wrote the paper. All authors read and approved the final manuscript.

Authors’ information

GLR is a postdoctoral researcher in the Biopharming Research Unit (BRU), IIH is a Senior Research Officer and Deputy Director of BRU, EPR is Professor of Microbiology and Director of BRU in the Department of Molecular and Cell Biology at University of Cape Town.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Biopharming Research Unit, Department of Molecular and Cell Biology, Faculty of Science, University of Cape Town, Cape Town, South Africa
(2)
Institute of Infectious Disease and Molecular Medicine, Faculty of Health Sciences, University of Cape Town, Cape Town, South Africa

References

  1. Fogell DJ, Martin RO, Groombridge JJ. Beak and feather disease virus in wild and captive parrots: an analysis of geographic and taxonomic distribution and methodological trends. Archives of virology. 2016;161:2059–74.View ArticlePubMedPubMed CentralGoogle Scholar
  2. Ortiz-Catedral L, McInnes K, Hauber ME, Brunton DH. First report of beak and feather disease virus (BFDV) in wild Red-fronted Parakeets (Cyanoramphus novaezelandiae) in New Zealand. Emu. 2009;109:244–7.View ArticleGoogle Scholar
  3. Rahaus M, Wolff MH. Psittacine beak and feather disease: a first survey of the distribution of beak and feather disease virus inside the population of captive psittacine birds in Germany. Journal of Veterinary Medicine, Series B. 2003;50:368–71.View ArticleGoogle Scholar
  4. Harkins GW, Martin DP, Christoffels A, Varsani A. Towards inferring the global movement of beak and feather disease virus. Virology. 2014;450:24–33.View ArticlePubMedGoogle Scholar
  5. Shearer PL, Sharp M, Bonne N, Clark P, Raidal SR. A quantitative, real-time polymerase chain reaction assay for beak and feather disease virus. J Virol Methods. 2009;159:98–104.View ArticlePubMedGoogle Scholar
  6. Ha H, Anderson I, Alley M, Springett B, Gartrell B. The prevalence of beak and feather disease virus infection in wild populations of parrots and cockatoos in New Zealand. New Zealand Veterinary Journal. 2007;55:235–8.View ArticlePubMedGoogle Scholar
  7. Schoemaker N, Dorrestein G, Latimer K, Lumeij J, Kik M, Van Der Hage M, Campagnoli R. Severe leukopenia and liver necrosis in young African grey parrots (Psittacus erithacus erithacus) infected with psittacine circovirus. Avian diseases. 2000;44:470–8.Google Scholar
  8. Ritchie BW, Niagro FD, Latimer KS, Lukert PD, Steffens WL, Rakich PM, Pritchard N. Ultrastructural, protein composition, and antigenic comparison of psittacine beak and feather disease virus purified from four genera of psittacine birds. Journal of Wildlife Diseases. 1990;26:196–203.View ArticlePubMedGoogle Scholar
  9. Raidal SR, McElnea CL, Cross GM. Seroprevalence of psittacine beak and feather disease in wild psittacine birds in New South Wales. Aust Vet J. 1993;70:137–9.View ArticlePubMedGoogle Scholar
  10. Bonne N, Shearer P, Sharp M, Clark P, Raidal S. Assessment of recombinant beak and feather disease virus capsid protein as a vaccine for psittacine beak and feather disease. Journal of General Virology. 2009;90:640–7.View ArticlePubMedGoogle Scholar
  11. Bert E, Tomassone L, Peccati C, Navarrete M, Sola S. Detection of beak and feather disease virus (BFDV) and avian polyomavirus (APV) DNA in psittacine birds in Italy. Journal of Veterinary Medicine, Series B. 2005;52:64–8.View ArticleGoogle Scholar
  12. Raidal S, Cross G. Control by vaccination of psittacine beak and feather disease in a mixed flock of Agapornis spp. Aust Vet Practit. 1994;24:178–80.Google Scholar
  13. Jergens AE, Brown TP, England TL. Psittacine Beak and Feather Disease Syndrome in a Cockatoo. Journal of the American Veterinary Medical Association. 1988;193:1292–4.PubMedGoogle Scholar
  14. Rahaus M, Desloges N, Probst S, Loebbert B, Lantermann W, Wolff M. Detection of beak and feather disease virus DNA in embryonated eggs of psittacine birds. VETERINARNI MEDICINA-PRAHA. 2008;53:53.Google Scholar
  15. Patterson EI, Swarbrick C, Roman N, Forwood JK, Raidal SR. Differential expression of two isolates of beak and feather disease virus capsid protein in Escherichia coli. J Virol Methods. 2013;189:118–24.View ArticlePubMedGoogle Scholar
  16. Todd D. Avian circovirus diseases: lessons for the study of PMWS. Veterinary Microbiology. 2004;98:169–74.View ArticlePubMedGoogle Scholar
  17. Ritchie BW, Niagro FD, Latimer KS, Steffens WL, Pesti D, Campagnoli RP, Lukert PD. Antibody-Response to and Maternal Immunity from an Experimental Psittacine Beak and Feather Disease Vaccine. American Journal of Veterinary Research. 1992;53:1512–8.PubMedGoogle Scholar
  18. Shearer PL, Sharp M, Bonne N, Clark P, Raidal SR. A blocking ELISA for the detection of antibodies to psittacine beak and feather disease virus (BFDV). J Virol Methods. 2009;158:136–40.View ArticlePubMedGoogle Scholar
  19. Bassami M, Ypelaar I, Berryman D, Wilcox G, Raidal S. Genetic diversity of beak and feather disease virus detected in psittacine species in Australia. Virology. 2001;279:392–400.View ArticlePubMedGoogle Scholar
  20. Crowther R, Berriman J, Curran W, Allan G, Todd D. Comparison of the structures of three circoviruses: chicken anemia virus, porcine circovirus type 2, and beak and feather disease virus. Journal of virology. 2003;77:13,036–41.View ArticleGoogle Scholar
  21. Bassami M, Berryman D, Wilcox G, Raidal S. Psittacine beak and feather disease virus nucleotide sequence analysis and its relationship to porcine circovirus, plant circoviruses, and chicken anaemia virus. Virology. 1998;249:453–9.View ArticlePubMedGoogle Scholar
  22. Sarker S, Terrón MC, Khandokar Y, Aragão D, Hardy JM, Radjainia M, Jiménez-Zaragoza M, De Pablo PJ, Coulibaly F, Luque D. Structural insights into the assembly and regulation of distinct viral capsid complexes. Nature communications. 2016;7:1-7.Google Scholar
  23. Davidson I, Artzi N, Shkoda I, Lublin A, Loeb E, Schat K. The contribution of feathers in the spread of chicken anemia virus. Virus Res. 2008;132:152–9.View ArticlePubMedGoogle Scholar
  24. Raidal SR, Firth GA, Cross GM. Vaccination and Challenge Studies with Psittacine Beak and Feather Disease Virus. Aust Vet J. 1993;70:437–41.View ArticlePubMedGoogle Scholar
  25. Shearer PL, Bonne N, Clark P, Sharp M, Raidal SR. Beak and feather disease virus infection in cockatiels (Nymphicus hollandicus). Avian Pathol. 2008;37:75–81.View ArticlePubMedGoogle Scholar
  26. Duvenage L, Hitzeroth II, Meyers AE, Rybicki EP. Expression in tobacco and purification of beak and feather disease virus capsid protein fused to elastin-like polypeptides. J Virol Methods. 2013;191:55–62.View ArticlePubMedGoogle Scholar
  27. Heath L, Williamson AL, Rybicki EP. The capsid protein of beak and feather disease virus binds to the viral DNA and is responsible for transporting the replication-associated protein into the nucleus. J Virol. 2006;80:7219–25.View ArticlePubMedPubMed CentralGoogle Scholar
  28. Sariya L. Prompiram PSASP: Expression of Recombinant Capsid Protein of Psittacine Beak and Feather Disease Virus Capsid Protein using Pichia pastoris system. Journal of Applied Animal Science. 2014;7:35–44.Google Scholar
  29. Sarker S, Ghorashi SA, Swarbrick CM, Khandokar YB, Himiari Z, Forwood JK, Raidal SR. An efficient approach for recombinant expression and purification of the viral capsid protein from beak and feather disease virus (BFDV) in Escherichia coli. Journal of virological methods. 2015;215:1–8.View ArticlePubMedGoogle Scholar
  30. Fachinger V, Bischoff R, Jedidia SB, Saalmuller A, Elbers K. The effect of vaccination against porcine circovirus type 2 in pigs suffering from porcine respiratory disease complex. Vaccine. 2008;26:1488–99.View ArticlePubMedGoogle Scholar
  31. Scott AN, Beckett A, Smyth JA, Ball NW, Palya V, Todd D. Serological diagnosis of goose circovirus infections. Avian Pathol. 2006;35:495–9.View ArticlePubMedGoogle Scholar
  32. Trible BR, Kerrigan M, Crossland N, Potter M, Faaberg K, Hesse R, Rowland RR. Antibody recognition of porcine circovirus type 2 capsid protein epitopes after vaccination, infection, and disease. Clinical and vaccine immunology. 2011;18:749–57.View ArticlePubMedPubMed CentralGoogle Scholar
  33. Pérez-Martín E, Gómez-Sebastián S, Argilaguet JM, Sibila M, Fort M, Nofrarías M, Kurtz S, Escribano JM, Segalés J, Rodríguez F. Immunity conferred by an experimental vaccine based on the recombinant PCV2 Cap protein expressed in Trichoplusia ni-larvae. Vaccine. 2010;28:2340–9.View ArticlePubMedGoogle Scholar
  34. Santi L, Huang Z, Mason H. Virus-like particles production in green plants. Methods. 2006;40:66–76.View ArticlePubMedPubMed CentralGoogle Scholar
  35. Scotti N, Rybicki EP. Virus-like particles produced in plants as potential vaccines. Expert review of vaccines. 2013;12(2):211–24.View ArticlePubMedGoogle Scholar
  36. Nerome K, Sugita S, Kuroda K, Hirose T, Matsuda S, Majima K, Kawasaki K, Shibata T, Poetri ON, Soejoedono RD. The large-scale production of an artificial influenza virus-like particle vaccine in silkworm pupae. Vaccine. 2015;33:117–25.View ArticlePubMedGoogle Scholar
  37. Lenz P, Thompson CD, Day PM, Bacot SM, Lowy DR, Schiller JT. Interaction of papillomavirus virus-like particles with human myeloid antigen-presenting cells. Clinical immunology. 2003;106:231–7.View ArticlePubMedGoogle Scholar
  38. Tagliamonte M, Tornesello M, Buonaguro F, Buonaguro L. Virus-Like Particles. Micro-and Nanotechnology in Vaccine Development. 2016;205Google Scholar
  39. Noad R, Roy P. Virus-like particles as immunogens. Trends in microbiology. 2003;11:438–44.View ArticlePubMedGoogle Scholar
  40. Nawagitgul P, Morozov I, Bolin SR, Harms PA, Sorden SD, Paul PS. Open reading frame 2 of porcine circovirus type 2 encodes a major capsid protein. Journal of General Virology. 2000;81:2281–7.View ArticlePubMedGoogle Scholar
  41. Stewart ME, Bonne N, Shearer P, Khalesi B, Sharp M, Raidal S. Baculovirus expression of beak and feather disease virus (BFDV) capsid protein capable of self-assembly and haemagglutination. J Virol Methods. 2007;141:181–7.View ArticlePubMedGoogle Scholar
  42. Wu P-C, Lin W-L, Wu C-M, Chi J-N, Chien M-S, Huang C. Characterization of porcine circovirus type 2 (PCV2) capsid particle assembly and its application to virus-like particle vaccine development. Applied microbiology and biotechnology. 2012;95:1501–7.View ArticlePubMedGoogle Scholar
  43. Varsani A, de Villiers GK, Regnard GL, Bragg RR, Kondiah K. Hitzeroth, II, Rybicki EP: A unique isolate of beak and feather disease virus isolated from budgerigars (Melopsittacus undulatus) in South Africa. Arch Virol. 2010;155:435–9.View ArticlePubMedGoogle Scholar
  44. Maclean J, Koekemoer M, Olivier A, Stewart D, Hitzeroth I, Rademacher T, Fischer R, Williamson A-L, Rybicki E. Optimization of human papillomavirus type 16 (HPV-16) L1 expression in plants: comparison of the suitability of different HPV-16 L1 gene variants and different cell-compartment localization. Journal of General Virology. 2007;88:1460–9.View ArticlePubMedGoogle Scholar
  45. Regnard GL, Halley-Stott RP, Tanzer FL, Hitzeroth II, Rybicki EP. High level protein expression in plants through the use of a novel autonomously replicating geminivirus shuttle vector. Plant Biotechnology Journal. 2010;8:38–46.View ArticlePubMedGoogle Scholar
  46. Takeda A, Sugiyama K, Nagano H, Mori M, Kaido M, Mise K, Tsuda S, Okuno T. Identification of a novel RNA silencing suppressor, NSs protein of Tomato spotted wilt virus. Febs Letters. 2002;532:75–9.View ArticlePubMedGoogle Scholar
  47. Sambrook J, Fritsch E, Maniatis T. Molecular cloning: A laboratory manual + Cold Spring Harbor. New York: Cold Spring Harbor Laboratory Press; 1989.Google Scholar
  48. Raidal S, Cross G. The haemagglutination spectrum of psittacine beak and feather disease virus. Avian Pathology. 1994;23:621–30.View ArticlePubMedGoogle Scholar
  49. Ritchie BW, Niagro FD, Lukert PD, Steffens WL, Latimer KS. Characterization of a New Virus from Cockatoos with Psittacine Beak and Feather Disease. Virology. 1989;171:83–8.View ArticlePubMedGoogle Scholar
  50. Thomas DR, Walmsley AM. Improved expression of recombinant plant-made hEGF. Plant cell reports. 2014;33:1–14.Google Scholar
  51. Kanagarajan S, Tolf C, Lundgren A, Waldenström J, Brodelius PE. Transient expression of hemagglutinin antigen from low pathogenic avian influenza A (H7N7) in Nicotiana benthamiana. PloS one. 2012;7:e33010.View ArticlePubMedPubMed CentralGoogle Scholar
  52. Meyers A, Chakauya E, Shephard E, Tanzer FL, Maclean J, Lynch A, Williamson A-L, Rybicki EP. Expression of HIV-1 antigens in plants as potential subunit vaccines. BMC biotechnology. 2008;8:53.View ArticlePubMedPubMed CentralGoogle Scholar
  53. D’Aoust MA, Lavoie PO, Couture MMJ, Trépanier S, Guay JM, Dargis M, Mongrand S, Landry N, Ward BJ, Vézina LP. Influenza virus-like particles produced by transient expression in Nicotiana benthamiana induce a protective immune response against a lethal viral challenge in mice. Plant Biotechnology Journal. 2008;6:930–40.View ArticlePubMedGoogle Scholar
  54. Liu L-J, Suzuki T, Tsunemitsu H, Kataoka M, Ngata N, Takeda N, Wakita T, Miyamura T, Li T-C. Efficient production of type 2 porcine circovirus-like particles by a recombinant baculovirus. Arch Virol. 2008;153:2291–5.View ArticlePubMedGoogle Scholar
  55. Todd D, Niagro F, Ritchie B, Curran W, Allan G, Lukert P, Latimer K, Steffens W III, McNulty M. Comparison of three animal viruses with circular single-stranded DNA genomes. Arch Virol. 1991;117:129–35.View ArticlePubMedGoogle Scholar
  56. Azizgolshani O, Garmann RF, Cadena-Nava R, Knobler CM, Gelbart WM. Reconstituted plant viral capsids can release genes to mammalian cells. Virology. 2013;441:12–7.View ArticlePubMedGoogle Scholar
  57. Chen T-H, Chen T-H, Hu C-C, Liao J-T, Lee C-W, Liao J-W, Lin M-Y, Liu H-J, Wang M-Y, Lin N-S. Induction of protective immunity in chickens immunized with plant-made chimeric Bamboo mosaic virus particles expressing very virulent Infectious bursal disease virus antigen. Virus research. 2012;166:109–15.View ArticlePubMedGoogle Scholar
  58. Lamprecht RL, Kennedy P, Huddy SM, Bethke S, Hendrikse M, Hitzeroth II, Rybicki EP. Production of Human papillomavirus pseudovirions in plants and their use in pseudovirion-based neutralisation assays in mammalian cells. Scientific reports. 2016;6:1-10.Google Scholar
  59. Trinkaus K, Wenisch S, Leiser R, Gravendyck M, Kaleta EF. Psittacine beak and feather disease infected cells show a pattern of apoptosis in psittacine skin. Avian Pathol. 1998;27:555–61.View ArticlePubMedGoogle Scholar
  60. Kock N, Hangartner P, Lucke V. Variation in clinical disease and species susceptibility to psittacine beak and feather disease in Zimbabwean lovebirds. The Onderstepoort journal of veterinary research. 1993;60:159.PubMedGoogle Scholar
  61. Greenacre CB, Latimer KS, Niagro FD, Campagnoli RP, Pesti D, Ritchie BW. Psittacine beak and feather disease in a scarlet macaw (Ara macao). Journal of the Association of Avian Veterinarians. 1992;6:95–8.Google Scholar
  62. Sanada Y, Sanada N, Kubo M. Electron microscopical observations of psittacine beak and feather disease in an Umbrella cockatoo (Cacatua alba). The Journal of veterinary medical science/the Japanese Society of Veterinary Science. 1999;61:1063–5.View ArticleGoogle Scholar
  63. McOrist S, Black DG, Pass DA, Scott PC, Marshall J. Beak and feather dystrophy in wild sulphur-crested cockatoos (Cacatua galerita). Journal of Wildlife Diseases. 1984;20:120–4.View ArticlePubMedGoogle Scholar
  64. Jacobson ER, Clubb S, Simpson C, Walsh M, Lothrop CD, Gaskin J, Bauer J, Hines S, Kollias GV, Poulos P, Harrison G. Feather and Beak Dystrophy and Necrosis in Cockatoos - Clinicopathological Evaluations. Journal of the American Veterinary Medical Association. 1986;189:999–1005.PubMedGoogle Scholar
  65. Wylie SL, Pass DA. Experimental reproduction of psittacine beak and feather disease/French Moult. Avian Pathol. 1987;16:269–81.View ArticlePubMedGoogle Scholar
  66. Pass DA, Perry RA. Psittacine Beak and Feather Disease - an Update. Australian Veterinary Practitioner. 1985;15:55–60.Google Scholar

Copyright

© The Author(s). 2017

Advertisement

Virology Journal

ISSN: 1743-422X