Skip to main content

Table 1 Primers for PCR amplification used during molecular cloning

From: Recombinant expression of beak and feather disease virus capsid protein and assembly of virus-like particles in Nicotiana benthamiana

Product Sense primer Antisense primer
Description Size (bp) Sequence (5′ - 3′) Cloning site Sequence (5′ - 3′) Cloning site
BFDV BKS1ZA_84 cp 6xHis   GTAACGCGTTAGGTACATGTGGGGCACCTCTAAC AflIII/MluI GTGATGGTGATGCCCTTCAGTTCTGGGATTATTGG  
796 GTAACGCGTTAGGTACATGTGGGGCACCTCTAAC AflIII/MluI CATCTCGAGCTAGTGATGGTGATGGTGATGCCCTTC XhoI
rbcs1-cTP BFDV BKS1ZA_84 cp 6xHis 959 GGACCATGGCTTCCTCTGTTATTTCCTC NcoI CATCTCGAGCTAGTGATGGTGATGGTGATGCCCTTC XhoI
BFDV BKS1ZA_84 cp 6xHis SEKDEL   GTAACGCGTTAGGTACATGTGGGGCACCTCTAAC AflIII/MluI CTCATCTTTCTCAGAGTGATGGTGATGGTGATGCC  
814 GTAACGCGTTAGGTACATGTGGGGCACCTCTAAC AflIII/MluI CCTCTCGAGCTAGAGCTCATCTTTCTCAGAGTGAT XhoI
LPH BFDV BKS1ZA_84 cp 6xHis SEKDEL 860 GGACCATGGAGTGGAGCTGGATCTTC NcoI CCTCTCGAGCTAGAGCTCATCTTTCTCAGAGTGAT XhoI
LPH BFDV BKS1ZA_84 cp 6xHis 840 GGACCATGGAGTGGAGCTGGATCTTC NcoI CATCTCGAGCTAGTGATGGTGATGGTGATGCCCTTC XhoI
  1. Underlined sequence indicates restriction enzyme sites