Open Access

Naturally occurring resistance mutations to inhibitors of HCV NS5A region and NS5B polymerase in DAA treatment-naïve patients

  • Stefania Paolucci1,
  • Loretta Fiorina1,
  • Bianca Mariani1,
  • Roberto Gulminetti2,
  • Stefano Novati2,
  • Giorgio Barbarini3,
  • Raffaele Bruno3 and
  • Fausto Baldanti1Email author
Virology Journal201310:355

https://doi.org/10.1186/1743-422X-10-355

Received: 23 September 2013

Accepted: 3 December 2013

Published: 17 December 2013

Abstract

Background

Direct-acting antiviral (DAA) agents target HCV proteins; some of these have already been approved for the treatment of HCV infection, while others are in development. However, selection of DAA-resistant viral variants may hamper treatment. The aim of this study was to illustrate potential natural DAA-resistance mutations in the HCV NS5A and NS5B regions of HCV genotypes 1a and 1b from DAA-naïve patients.

Methods

Direct sequencing of HCV NS5A and NS5B regions was performed in 32 patients infected with HCV genotype 1a and 30 patients infected with HCV genotype 1b; all subjects were naïve to DAAs.

Results

In genotype 1a strains, resistance mutations in NS5A (M28V, L31M and H58P) were observed in 4/32 (12.5%) patients, and resistance mutations in NS5B (V321I, M426L, Y448H, Y452H) were observed in 4/32 (12.5%) patients. In genotype 1b, resistance mutations in NS5A (L28V, L31M, Q54H, Y93H and I280V) were observed in 16/30 (53.3%) patients, while resistance mutations in NS5B (L159F, V321I, C316N, M426L, Y452H, R465G and V499A) were observed in 27/30 (90%) patients.

Conclusions

Mutations conferring DAA resistance were detected in NS5A and NS5B of HCV genotypes 1a and 1b from DAA-naïve patients. Although some mutations confer only a low level of resistance, the presence at baseline of mutated HCV variants should be taken into consideration in the context of DAA therapy.

Keywords

Hepatitis C virusHCV baseline resistanceNS5A and NS5B genesDAA inhibitors

Background

Hepatitis C virus (HCV) is classified into six genotypes (1–6) and more than 100 subtypes. The most common genotypes in Western countries are 1a and 1b [1]. Peginterferon/ribavirin (PegIFN/RBV) for the treatment of HCV infection is burdened by adverse reactions in at least 10% of patients [2]. Moreover, a sustained virological response is achieved in only 50% of patients infected with HCV genotype 1 [3]. PegIFN/RBV treatment failure is mainly attributed to its low efficacy against genotypes 1 and 4, but also, to some extent to its side effects [3, 4]. Recently developed direct-acting antiviral agents (DAAs) are predicted to have a major impact both in combination with PegIFN/RBV, as well as in IFN-free regimens and telaprevir and boceprevir have now been approved as standard of care treatment [5]. Targets for DAA include HCV NS3 protease, NS5B polymerase and NS5A protein which are essential for virus replication. [612].

Nevertheless, the combination of a high HCV replication rate, the low fidelity of HCV polymerase and selective pressures by the immune system and drug treatment lead to the in vivo development of viral quasispecies with high sequence diversity among various genotypes and subtypes [13, 14] with the potential accumulation of virus variants showing mutations with varying degrees of resistance to DAAs [1113, 1522], even in the absence of pre-existing drug-exposure [17, 2326]. In particular, natural changes in HCV NS5A and NS5B amino acids (aa) associated with reduced drug susceptibility have been observed in treatment naïve patients [17, 27, 28].

The aim of this study was to illustrate potential DAA-resistant variants in HCV NS5A and NS5B from DAA-naïve patients infected with genotypes 1a or 1b HCV strains.

Materials and methods

HCV DAA-naive patients referred to our hospital between 2011 and 2012 were included in this study. A comparable number of sequential patients infected with HCV genotypes 1a or 1b was considered in the analysis. From each patient, serum samples were prospectively collected following approval of the study by the Ethics Committee of the Fondazione IRCCS Policlinico San Matteo (protocol no. 20080009620) and after obtaining written informed consent. HCV genotypes were defined using the Versant HCV Genotype 2.0 Assay LiPA (Siemens Healthcare Diagnostic Inc., Tarrytown, NY USA). NS5A and NS5B sequencing was used to differentiate HCV genotypes 1a and 1b. Data were analyzed with the Blast program (http://blast.ncbi.nlm.nih.gov).

Viral RNA was extracted from serum samples using the automatic Easy Mag extractor (Biomerieux, Lyon, France), and full-length HCV NS5A and NS5B genes were amplified using Superscript III One-step enzyme with Platinum Taq (Invitrogen, Carlisbad, CA, USA) in a nested RT-PCR. Primers used in the RT-PCR and nested PCR, spanning NS5A aa 1 to 406 and NS5B aa 1 to 547, are shown in Table 1. The PCR products in the first PCR round were obtained by using the following conditions: 30′ at 45°C for the reverse transcription followed by 10′ at 94°C, and then 50 cycles at 94°C for 1′, 60°C for 1′ and 68°C for 2′, with an extension at 68°C for 10′ in all reactions. Three microliters from the first PCR reaction were used in the nested PCR with the following conditions: denaturation step at 94°C for 10′ and then 30 cycles at 94°C for 1′, 60°C for 1′ and 72°C for 2′, with an extension at 72°C for 10′in the NS5A gene; and denaturation step at 94°C for 10′ and then 30 cycles at 94°C for 1′, 65°C for 1′ and 72°C for 2′, with an extension at 72°C for 10′ in the NS5B gene.
Table 1

Amplification and sequencing primers for HCV NS5A and NS5B in genotypes 1a and 1b

Gene

Primer name

Primer sequence

GT1a* NS5A

HCV-1a NS5A Fwd out

GACATCTGGGACTGGATATGYGA

 

HCV-1a NS5A Rew out

GTCCAGGWRTARGACATYGAGCA

 

HCV-1a NS5A Fwd inn

GATATGYGAGGTGYTGAGCGA

 

HCV-1a NS5A Rew inn

GAGCARCACACGACRTCYTC

 

HCV-1a NS5A Rew Seq

AAGGAGTCCARRATCACCAC

 

HCV-1a NS5B Fwd out

GGAGCCKGGRGATCCRGATCTYAGC

GT1a* NS5B

HCV-1a NS5B Rew out

GTTGGGGAGGAGGTAGATGCCTA

 

HCV-1a NS5B Fwd inn

GAYGTCGTGTGCTGCTCRATGTC

 

HCV-1a NS5B Rew inn

GAGACACGCTGTGATAAATGTCTCCC

 

HCV-1a NS5B Fwd Seq

TCGTAAGCCAGCTCGYCTCATCG

 

HCV-1a NS5B Rew Seq

CCTATTGATTTCACCTGGAGAG

 

HCV-1b NS5A Fwd out

GGATYAAYGARGACTGYTCYAC

 

HCV-1b NS5A Rew out

GACCARGACCCGTCRCTGAGRT

 

HCV-1b NS5A Fwd inn

GGGAYTGGATATGCACGGT

GT1b § NS5A

HCV-1b NS5A Rew inn

GGCATGGAGGARTAYGAC

 

HCV-1b NS5A Fwd Seq

ARTTGTCTGCGCCTTCYYTGAAGG

 

HCV-1b NS5B Fwd out

CGYTGAGTCRTAYTCCTCCATGC

 

HCV-1b NS5B Rew out

GGGCRCGAGACASGCTGTGATA

 

HCV-1b NS5B Fwd inn

CTCAGYGACGGGTCYTGGTC

GT1b § NS5B

HCV-1b NS5B Rew inn

GCTGTGATATATGTCTCCCC

 

HCV-1b NS5B Fwd Seq2

TGGGRGTHCGYGTRTGCGAG

 

HCV-1b NS5B Rew Seq3

AGCATYGTGCAGTCCYGGAGC

*Genotype 1a; § Genotype 1b.

Direct sequencing of PCR products was performed using an automatic sequencer (ABI PRISM 3100 genetic analyzer DNA Sequencer, Applied Biosystems, Foster City, CA, USA) and the BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA). Sequencing primers used to complete the NS5A and NS5B analyses are shown in Table 1.

Nucleotide sequences were assembled using the Sequencer 5.0 (Gene Codes Corp., Ann Arbor, MI) software program. Nucleotide sequences were aligned with reference sequences of different subtypes. GeneBank accession numbers for NS5A and NS5B reference sequences are AF009606 for HCV genotype 1a, and AY045702 for genotype 1b.

The sequences reported in this study have been submitted to the GenBank database under accession numbers KF667756 - KF667879.

Results

The clinical and virological characteristics of the patients considered in the study are provided in Table 2. Most patients (26/32, 81%) were naive to PegIFN and RBV, while none had ever been treated with HCV NS3, NS5A or NS5B inhibitors. Ten out of 62 (16.2%) patients were co-infected with HIV and under treatment with highly active antiretroviral therapy (HAART), while 52/62 (83.8) were HCV mono-infected (Table 2).
Table 2

Patient characteristics by HCV genotype

 

HCV genotype (no. of patients)

 

Characteristics

1a (n = 32)

1b (n = 30)

Gender

  

Male

22 (68.7%)

17 (56.6%)

Female

10 (31.2%)

13 (43.3%)

Demographics

  

Italian

31 (96.8%)

25 (83.3%)

Others

1 (3.1%)

5 (16.6%)

No. of HIV-1/HCV co- infected patients receiving HAART

8 (25%)

2 (6.6%)

Median HCV viral load (UI/ml) in HCV mono-infected patients

1,614,064 (range 6,743-7,985,320)

991,975 (range 3,470-4,381,000)

Median HCV viral load (UI/ml) in HCV/HIV co-infected patients

2,367,635 (range 46,801-7,985,320)

473,597 (range 46,801-900,393)

No. of patients naïve to peg IFN/RBV

26 (81.2%)

29 (96.6%)

HIV, Human Immunodeficiency Virus; HCV, Hepatitis C Virus; HAART, Highly Active Anti-Retroviral Therapy; IFN, Interferon; RBV, Ribavirin.

DAA resistance mutations were detected in both genotypes 1a and 1b strains from DAA naïve HCV patients (Table 3 and Table 4). Overall, the median frequency of single mutations was 4.75% (range 3.1% and 36.6%). In detail, in genotype 1a strains, mutations in the NS5A region associated with resistance to Daclatasvir, Ledipasvir and GSK805 were observed in 4/32 (12.5%) patients (Table 3); mutations in the NS5B region associated with resistance to PSI-352938, Filibuvir and Tegobuvir were observed in 4/32 (12.5%) patients (Table 4). In genotype 1b strains, mutations in the NS5A region associated with resistance to Daclatasvir, Samatasvir, Ledipasvir and GSK805 were observed in 16/30 (53.3%) patients (Table 3); mutations in the NS5B region associated with resistance to Sofosbuvir, Mericitabine, PSI-352938, Tegobuvir, HCV-796, Filibuvir, JTK-109 and Deleobuvir were observed in 27/30 (90%) patients (Table 4). Of note, the mutation V499A was constitutively present in NS5B of all genotype 1a strains and mutation Q30R was present in NS5A of all genotype 1b strains. Overall, HCV NS5A and NS5B resistance mutations in HCV mono-infected patients were found in 30/62 (48.3%) patients.
Table 3

Amino acid mutations in the HCV NS5A protein in DAA-naïve patients infected with HCV genotypes 1a (n = 32) or 1b (n = 30)

DAAs

NS5A mutations in DAA-naïve patients

Genotype 1a

Fold change in EC50

Genotype 1b

Fold change in EC50

References

Daclatasvir

M28V (1/32, 3.1%) α

1.3

L28M/V (1/30,3.3%)

2.0

[15, 17, 19]

 

Q30E/H/R/K

 

R30H

  

Daclatasvir

L31M/(1/32, 3.1%)

341

L31M (2/30, 6.6%)

3

[15, 17, 19]

Ledipasvir

L31M/(1/32, 3.1%)

140

L31M

 

[29]

GSK805

L31M/(1/32, 3.1%)

>150

L31M

 

[30]

Samatasvir

L31M

 

L31M (2/30, 6.6%)

3.6

[31]

 

P32L

 

P32L

  

Daclatasvir

Q54H/L/N

 

Q54H (8/30, 26.6%)

1.0

[19]

Daclatasvir

H58P (2/32, 6.2%)

1.2

P58S/T/L

 

[19]

 

N69T

 

N69T

  
 

A92V

 

A92V

  

Daclatasvir

Y93C/H/N

 

Y93H (3/30, 10%)

24

[15, 17, 19]

Ledipasvir

Y93C/H/N

 

Y93H (3/30, 10%)

1319

[29]

Samatasvir

Y93C/H/N

 

Y93H (3/30, 10%)

93

[31]

 

V153M

 

V153M

  
 

R157W

 

R157W

  
 

V198A

 

V198A

  
 

M202L

 

M202L

  
 

P223S

 

P223S

  
 

M265V

 

M265V

  

GSK805

I280V

 

I280V (2/30, 6.6%)

<2.0

[30]

 

V298A

 

V298A

  
 

V362A

 

V362A

  
 

S364P

 

S364P

  
 

S368P

 

S368P

  

αAmino acid changes conferring resistance to NS5A inhibitors are reported in italics. The number and % of patients with mutated strains is reported in brackets.

GeneBank accession number of NS5A reference sequence for HCV genotype 1a is AF009606, and for genotype 1b, AY045702.

Table 4

Amino acid mutations in the HCV NS5B protein in DAA-naïve patients infected with HCV genotypes 1a (n = 32) or 1b (n = 30)

 

NS5B mutations in DAA-naïve patients

DAAs

Genotype 1a

Fold change in EC50

Genotype 1b

Fold change in EC50

References

 

S96Tγ

 

S96T

  
 

N142T

 

N142T

  

Sofosbuvir + Mericitabine

L159F

 

L159F (7/30, 23.3%)

Xβ

[32]

 

C223H/Y

 

C223H/Y

  
 

S282T

 

S282T

  
 

L320F

 

L320F

  

PSI-352938

V321I (1/32, 3.1%) α

2.0

V321I (1/30, 3.3%)

2.0

[17, 33]

Tegobuvir + HCV796

C316Y/N/F/S

 

C316N (11/30, 36.6%)

3.0-5.2

[17, 34]

 

V362A

 

V362A

  
 

S365A/T

 

S365A/T

  
 

M414T

 

M414T

  
 

L419M/S

 

L419M/S

  
 

A421V

 

A421V

  
 

R422K

 

R422K

  
 

M423I/V/T

 

M423I/V/T

  

Filibuvir

M426L (1/32, 3.1%)

0.8

M426L (2/30, 6.6%)

0.8

[21]

 

C445F

 

C445F

  

Tegobuvir

Y448H (1/32, 3.1%)

36.0

Y448H

 

[34]

Tegobuvir

Y452H (1/32, 3.1%)

6.9

Y452H (1/30, 3.3%)

6.9

[34]

Tegobuvir

R465G

 

R465G (1/30, 3.3%)

1.1

[34]

 

I482L/T

 

I482L/T

  
 

A486V

 

A486V

  
 

V494A

 

V494A

  
 

P495A/L/S/T

 

P495A/L/S/T

  
 

P496A/S

 

P496A/S

  

JTK-109 + Deleobuvir

A499T

 

V499A (4/30, 13.3%)

3.0

[17, 35]

 

G554D

 

G554D

  
 

S556G/D/N

 

S556G/D/N

  
 

D559G/N

 

D559G/N

  

αAmino acid changes conferring resistance to NS5B inhibitors are reported in italics. The number and % of patients with mutated strains is reported in brackets. βResistance levels are reported only when associated with L320F. GeneBank NS5B reference sequence accession number for HCV genotype 1a is AF009606, and for genotype 1b, AY045702.

HCV NS5A and NS5B resistance mutations in HCV/HIV co-infected patients were found in 3/10 (30%) patients with no statistical difference vs mono-infected patients (p = 0.32). In detail, one patient had the M28V mutation in NS5A, one patient had Y448H in NS5B and one patient had H58P + Y452H in NS5A and NS5B, respectively.

Among the 30 patients infected with genotype 1b strains, two (6.6%) had a mixture of virus variants carrying multiple NS5A resistance mutations, while eight (26.6%) exhibited a mixture of strains with multiple NS5B resistance mutations. In detail, in NS5A of two patients carrying genotype 1b, the mixture Q54H + Y93H was observed. In NS5B of eight patients with genotype 1b, eight different mixtures were observed (L159F + V499A; L159F + C316N; L159F + C316N + V499A; L159F + C316N + M426L; C316N + M426L; C316N + V499A; V321I + V499A and C316N + R465G + V499A). In addition, combinations of multiple resistance variants in both the NS5A and NS5B genes of the same HCV strain, were observed in 1/32 (3.1%) patients with HCV genotype 1a and 8/30 (26.6%) patients with HCV genotype 1b. In particular, a patient with genotype 1a infection had the H58P mutation in NS5A and Y452H in NS5B, while in the eight patients carrying genotype 1b, 3 patients had Q54H in NS5A and C316N in NS5B, one patient had L31M in NS5A and C316N in NS5B, one patient had L31M in NS5A and Y452H in NS5B, one patient had Q54H + Y93H in NS5A and C316N + V499A in NS5B, one patient had Q54H in NS5A and L159F in NS5B and one patient had Q54H in NS5A and L159F + C316N in NS5B.

Notably, all aa variants detected in DAA-naïve patients were low-level resistance mutations except for the mutation Y448H found in the NS5B gene of 1/32 (3.1%) HCV genotype 1a strains which confers higher-level resistance to Tegobuvir and Y93H observed in NS5A of 3/30 (10%) HCV genotype 1b strains which confers higher-level resistance to Daclatasvir, Ledipasvir and Samatasvir.

Discussion

In this study, 62 patients with genotype 1a or 1b HCV strains were evaluated to determine the frequency of HCV DAA-resistant variants in patients naïve to DAA treatment. The identification of baseline resistance mutations to anti-HCV inhibitors is crucial for defining new therapeutic approaches. Relevant natural aa polymorphisms were found in genotypes 1a and 1b. Some major resistance mutations and other mutations conferring low level resistance to NS5A HCV inhibitors (Daclatasvir, Ledipasvir, GSK805 and Samatasvir), as well as nucleosides (Sofosbuvir, Mericitabine, and PSI-352938) and non-nucleosides (Tegobuvir, Filibuvir, HCV-796, JTK-109 and Deleobuvir) were observed. Similarly, resistance mutations to NS5B HCV inhibitors were confirmed in DAA naïve patients with HCV genotypes 1a and 1b [11, 12, 17, 19, 25, 2932, 35, 36]. Among major mutations in the NS5A gene conferring high level resistance to NS5A inhibitors [17, 19, 30, 31], Q30E/H/K and Y93N/C were not observed, while L31M and Y93H were detected in 2 and 3 patients respectively. A major mutation in the NS5B gene S282T which confers high level resistance to polymerase nucleotide inhibitors [8, 17, 37], was not observed, while Y448H associated with reduced susceptibility to NS5B non-nucleoside polymerase inhibitors was detected in one patient. Resistance mutations were not observed more frequently in HCV/HIV co-infected patients than in HCV mono-infected patients.

Overall, the median frequency of single mutations observed in the NS5A and NS5B genes analyzed was low as reported in other geographical regions [17, 27, 28]. In addition, the prevalence of patients with resistance mutations in both genes at baseline was lower in HCV genotype 1a than in HCV genotype 1b infected patients. The higher prevalence of mutations in genotype 1b is due to the presence of C316N, which confers low level resistance to Tegobuvir and HCV-796 in most genotype 1b strains. In addition, in HCV genotype 1b infected patients, the frequency of multiple variant combinations was lower in NS5A than in NS5B. Moreover, in HCV genotype 1a infected patients, combinations of multiple resistance mutations in both NS5A and NS5B of single patients were observed with significant frequency in both HCV genotype 1a and 1b infected patients. It should be underlined that while the Q54H + Y93H combination has already been reported [19] to provide moderate resistance to Daclatasvir, the other combinations have never been investigated, and their level of resistance is not known. In general, greater heterogeneity was confirmed in HCV genotype 1b strains [26, 27].

Only 3.1% of patients with HCV genotype 1a and 10% with HCV genotype 1b had viral strains with mutations conferring higher-level resistance to Tegobuvir, Daclatasvir, Samatasvir Ledipasvir and GSK805. Although the presence of preexisting single or double mutations might not confer a significant level of resistance or preclude successful treatment as observed in PI treatment [23], baseline resistance should be taken into consideration in the prospect of HCV IFN-free DAA therapy. Of particular interest are patients carrying combinations of multiple resistance mutations in both the NS5A and NS5B genes, which might increase the possibility of failure in patients treated with multiple DAA containing regimens.

Further studies are needed to better evaluate the role of all variants and the influence which they might have in modulating resistance levels or susceptibility to HCV drugs.

The sustained response in most patients, even when carrying DAA baseline resistance, is probably due to the clearance of HCV. Although there is the possibility that baseline resistant variants may result in viral breakthroughs during treatment [20, 27, 29], the clinical impact of resistance-mutations in DAA-naïve patients and their influence on the ability of the virus to replicate in vivo remain unclear [14, 17, 25]. Thus, for patients receiving DAA interferon free regimens, or those who will receive in the near future only combined classes of HCV inhibitors, the potential role of DAA-resistant variants prior to treatment should be evaluated in all target genes since their clinical relevance could be useful in the management of new HCV therapies.

Consent

Written informed consent was obtained from patients for publication of the data in this manuscript and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.

Declarations

Acknowledgements

The authors thank Daniela Sartori for manuscript editing and Laurene Kelly for revision of the English. The work was supported by the Ministero della Salute, Ricerca Corrente grant no. 80207.

Authors’ Affiliations

(1)
Molecular Virology Unit, Virology and Microbiology Department, Fondazione IRCCS Policlinico San Matteo
(2)
Institute of Infectious Diseases, University of Pavia
(3)
Division of Infectious and Tropical Diseases, Fondazione IRCCS Policlinico San Matteo

References

  1. Nakano T, Lau GM, Lau GM, Sugiyama M, Mizokami M: An updated analysis of hepatitis C virus genotypes and subtypes based on the complete coding region. Liver Int 2012, 32: 339-345. 10.1111/j.1478-3231.2011.02684.xPubMedView ArticleGoogle Scholar
  2. Manns MP, McHutchison JG, Gordon SC, Rustgi VK, Shiffman M, Reindollar R, Goodman ZD, Koury K, Ling M, Albrecht JK: Peginterferon alfa-2b plus ribavirin compared with interferon alfa-2b plus ribavirin for initial treatment of chronic hepatitis C: a randomised trial. Lancet 2001, 358: 958-965. 10.1016/S0140-6736(01)06102-5PubMedView ArticleGoogle Scholar
  3. Hadziyannis SJ, Sette H Jr, Morgan TR, Balan V, Diago M, Marcellin P, Ramadori G, Bodenheimer H Jr, Bernstein D, Rizzetto M, Zeuzem S, Pockros PJ, Lin A, Ackrill AM, PEGASYS International Study Group: Peginterferon-alpha2a and ribavirin combination therapy in chronic hepatitis C: a randomized study of treatment duration and ribavirin dose. Ann Intern Med Mar 2004, 140: 346-355. 10.7326/0003-4819-140-5-200403020-00010View ArticleGoogle Scholar
  4. Kowdley KV: Hematologic side effects of interferon and ribavirin therapy. J Clin Gastroenterol 2005,39(1 Suppl):S3-S8.PubMedView ArticleGoogle Scholar
  5. Hunt D, Pockros P: What are the promising new therapies in the field of chronic hepatitis C after the first-generation direct-acting antivirals? Curr Gastroenterol 2013, 15: 303.View ArticleGoogle Scholar
  6. Lenz O, Verbinnen T, Lin TI, Vijgen L, Cummings MD, Lindberg J, Berke JM, Dehertogh P, Fransen E, Scholliers A, Vermeiren K, Ivens T, Raboisson P, Edlund M, Storm S, Vrang L, de Kock H, Fanning GC, Simmen KA: In vitro resistance profile of the hepatitis C virus NS3/4A protease inhibitor TMC435. Antimicrob Agents Chemother 2010, 54: 1878-1887. 10.1128/AAC.01452-09PubMedPubMed CentralView ArticleGoogle Scholar
  7. Lagacé L, White PW, Bousquet C, Dansereau N, Dô F, Llinas-Brunet M, Marquis M, Massariol MJ, Maurice R, Spickler C, Thibeault D, Triki I, Zhao S, Kukolj G: In vitro resistance profile of the hepatitis C virus NS3 protease inhibitor BI 201335. Antimicrob Agents Chemother 2012, 56: 569-572. 10.1128/AAC.05166-11PubMedPubMed CentralView ArticleGoogle Scholar
  8. Membreno FE, Lawitz EJ: The HCV NS5B nucleoside and non-nucleoside inhibitors. Clin Liver Dis 2011, 15: 611-626. 10.1016/j.cld.2011.05.003PubMedView ArticleGoogle Scholar
  9. Chee GM, Poordad F: Interferon free hepatitis C treatment regimens: the beginning of another era. Curr Gastroenterol 2012, 14: 74-77. 10.1007/s11894-011-0229-1View ArticleGoogle Scholar
  10. Hagan LM, Schinazi RF: Best strategies for global HCV eradication. Liver Int 2013,33(Suppl 1):68-79.PubMedPubMed CentralView ArticleGoogle Scholar
  11. Pawlotsky JM: NS5A inhibitors in the treatment of hepatitis C. J Hepatol 2013, 59: 375-382. 10.1016/j.jhep.2013.03.030PubMedView ArticleGoogle Scholar
  12. Alves R, Queiroz AT, Pessoa MG, da Silva EF, Mazo DF, Carrilho FJ, Carvalho-Filho RJ, de Carvalho IM: The presence of resistance mutations to protease and polymerase inhibitors in Hepatitis C virus sequences from the Los Alamos databank. J Viral Hepat 2013, 20: 414-421. 10.1111/jvh.12051PubMedView ArticleGoogle Scholar
  13. Zeuzem S: Clinical implications of hepatitis C viral kinetics. Hepatol 1999,31(1):61-64.View ArticleGoogle Scholar
  14. Palanisamy N, Danielsson A, Kokkula C, Yin H, Bondeson K, Wesslén L, Duberg AS, Lennerstrand J: Implications of baseline polymorphisms for potential resistance to NS3 protease inhibitors in Hepatitis C virus genotypes 1a, 2b and 3a. Antiviral Res 2013, 99: 12-17. 10.1016/j.antiviral.2013.04.018PubMedView ArticleGoogle Scholar
  15. Fridell RA, Qiu D, Wang C, Valera L, Gao M: Resistance analysis of the hepatitis C virus NS5A inhibitor BMS-790052 in an in vitro replicon system. Antimicrob Agents Chemother 2010, 54: 3641-3650. 10.1128/AAC.00556-10PubMedPubMed CentralView ArticleGoogle Scholar
  16. Adiwijaya BS, Herrmann E, Hare B, Kieffer T, Lin C, Kwong AD, Garg V, Randle JC, Sarrazin C, Zeuzem S, Caron PR: A multi-variant, viral dynamic model of genotype 1 HCV to assess the in vivo evolution of protease-inhibitor resistant variants. PLoS Comput Biol 2010,15(6(4)):e1000745.View ArticleGoogle Scholar
  17. Bartels DJ, Sullivan JC, Zhang EZ, Tigges AM, Dorrian JL, De Meyer S, Takemoto D, Dondero E, Kwong AD, Picchio G, Kieffer TL: Hepatitis C virus variants with decreased sensitivity to direct-acting antivirals (DAAs) were rarely observed in DAA-naive patients prior to treatment. J Virol 2013, 87: 1544-1553. 10.1128/JVI.02294-12PubMedPubMed CentralView ArticleGoogle Scholar
  18. Delang L, Vliegen I, Leyssen P, Neyts J: In vitro selection and characterization of HCV replicons resistant to multiple non-nucleoside polymerase inhibitors. J Hepatol 2012, 56: 41-48. 10.1016/j.jhep.2011.04.016PubMedView ArticleGoogle Scholar
  19. Fridell RA, Wang C, Sun JH, O’Boyle DR 2nd, Nower P, Valera L, Qiu D, Roberts S, Huang X, Kienzle B, Bifano M, Nettles RE, Gao M: Genotypic and phenotypic analysis of variants resistant to hepatitis C virus nonstructural protein 5A replication complex inhibitor BMS-790052 in humans: in vitro and in vivo correlations. Hepatology 2011, 54: 1924-1935. 10.1002/hep.24594PubMedView ArticleGoogle Scholar
  20. Pelosi LA, Voss S, Liu M, Gao M, Lemm JA: Effect on hepatitis C virus replication of combinations of direct-acting antivirals, including NS5A inhibitor daclatasvir. Antimicrob Agents Chemother 2012, 56: 5230-5239. 10.1128/AAC.01209-12PubMedPubMed CentralView ArticleGoogle Scholar
  21. Troke PJ, Lewis M, Simpson P, Gore K, Hammond J, Craig C, Westby M: Characterization of resistance to the nonnucleoside NS5B inhibitor filibuvir in hepatitis C virus-infected patients. Antimicrob Agents Chemother 2012, 56: 1331-1341. 10.1128/AAC.05611-11PubMedPubMed CentralView ArticleGoogle Scholar
  22. Barreiro P, Vispo E, Poveda E, Fernández-Montero JV, Soriano V: Hepatitis C therapy: highlights from the 2012 annual meeting of the European Association for the Study of the Liver. Clin Infect Dis 2013, 56: 560-566. 10.1093/cid/cis915PubMedView ArticleGoogle Scholar
  23. Bartels DJ, Zhou Y, Zhang EZ, Marcial M, Byrn RA, Pfeiffer T, Tigges AM, Adiwijaya BS, Lin C, Kwong AD, Kieffer TL: Natural prevalence of hepatitis C virus variants with decreased sensitivity to NS3.4A protease inhibitors in treatment-naive subjects. J Infect Dis 2008, 198: 800-807. 10.1086/591141PubMedView ArticleGoogle Scholar
  24. Kuntzen T, Timm J, Berical A, Lennon N, Berlin AM, Young SK, Lee B, Heckerman D, Carlson J, Reyor LL, Kleyman M, McMahon CM, Birch C, Schulze Zur Wiesch J, Ledlie T, Koehrsen M, Kodira C, Roberts AD, Lauer GM, Rosen HR, Bihl F, Cerny A, Spengler U, Liu Z, Kim AY, Xing Y, Schneidewind A, Madey MA, Fleckenstein JF, Park VM, et al.: Naturally occurring dominant resistance mutations to hepatitis C virus protease and polymerase inhibitors in treatment-naïve patients. Hepatology 2008, 48: 1769-1778. 10.1002/hep.22549PubMedPubMed CentralView ArticleGoogle Scholar
  25. Halfon P, Sarrazin C: Future treatment of chronic hepatitis C with direct acting antivirals: is resistance important? Liver Int 2012,32(Suppl 1):79-87.PubMedView ArticleGoogle Scholar
  26. Paolucci S, Fiorina L, Piralla A, Gulminetti R, Novati S, Barbarini G, Sacchi P, Gatti M, Dossena L, Baldanti F: Naturally occurring mutations to HCV protease inhibitors in treatment-naïve patients. Virol J 2012, 24: 9-245.Google Scholar
  27. Suzuki F, Sezaki H, Akuta N, Suzuki Y, Seko Y, Kawamura Y, Hosaka T, Kobayashi M, Saito S, Arase Y, Ikeda K, Kobayashi M, Mineta R, Watahiki S, Miyakawa Y, Kumada H: Prevalence of hepatitis C virus variants resistant to NS3 protease inhibitors or the NS5A inhibitor (BMS-790052) in hepatitis patients with genotype 1b. J Clin Virol 2012, 54: 352-354. 10.1016/j.jcv.2012.04.024PubMedView ArticleGoogle Scholar
  28. Plaza Z, Soriano V, Vispo E, del Mar Gonzalez M, Barreiro P, Seclén E, Poveda E: Prevalence of natural polymorphisms at the HCV NS5A gene associated with resistance to daclatasvir, an NS5A inhibitor. Antivir Ther 2012, 17: 921-926. 10.3851/IMP2091PubMedView ArticleGoogle Scholar
  29. Lawitz EJ, Gruener D, Hill JM, Marbury T, Moorehead L, Mathias A, Cheng G, Link JO, Wong KA, Mo H, McHutchison JG, Brainard DM: A phase 1, randomized, placebo-controlled, 3-day, dose-ranging study of GS-5885, an NS5A inhibitor, in patients with genotype 1 hepatitis C. J Hepatol 2012, 57: 24-31. 10.1016/j.jhep.2011.12.029PubMedView ArticleGoogle Scholar
  30. Walker J, Crosby R, Wang A, Woldu E, Vamathevan J, Voitenleitner C, You S, Remlinger K, Duan M, Kazmierski W, Hamatake R: Preclinical characterization of GSK2336805, a novel inhibitor of hepatitis C virus replication that selects for resistance in NS5A. Antimicrob Agents Chemother 2013. [Epub ahead of print]Google Scholar
  31. McCarville JF, Chapron C, LaColla M, Bilello JP, Lallos LB, Seifer M, Standring DN: Hepatitis C Virus NS5A Inhibitor IDX719 Demonstrates Potent, Pan-genotypic Activity in Preclinical and Clinical Studies [abstract]. Hepatol Int 2013, 7: S330.Google Scholar
  32. Tong X, Le Pogam S, Li L, Haines K, Piso K, Baronas V, Yan JM, So SS, Klumpp K, Nájera I: In Vivo Emergence of a Novel Mutant L159F/L320F in the NS5B Polymerase Confers Low-Level Resistance to the HCV Polymerase Inhibitors Mericitabine and Sofosbuvir. J Infect Dis 2013. [Epub ahead of print]Google Scholar
  33. Lam AM, Espiritu C, Bansal S, Micolochick Steuer HM, Zennou V, Otto MJ, Furman PA: Hepatitis C virus nucleotide inhibitors PSI-352938 and PSI-353661 exhibit a novel mechanism of resistance requiring multiple mutations within replicon RNA. J Virol 2011, 85: 12334-12342. 10.1128/JVI.05639-11PubMedPubMed CentralView ArticleGoogle Scholar
  34. Shih IH, Vliegen I, Peng B, Yang H, Hebner C, Paeshuyse J, Pürstinger G, Fenaux M, Tian Y, Mabery E, Qi X, Bahador G, Paulson M, Lehman LS, Bondy S, Tse W, Reiser H, Lee WA, Schmitz U, Neyts J, Zhong W: Mechanistic characterization of GS-9190 (Tegobuvir), a novel nonnucleoside inhibitor of hepatitis C virus NS5B polymerase. Antimicrob Agents Chemother 2011, 55: 4196-4203. 10.1128/AAC.00307-11PubMedPubMed CentralView ArticleGoogle Scholar
  35. Larrey D, Lohse AW, Trepo C, Bronowicki JP, Arastéh K, Bourlière M, Calleja JL, Stern JO, Nehmiz G, Abdallah N, Berger KL, Marquis M, Steffgen J, Kukolj G, BI 207127 Study Group: Antiviral effect, safety, and pharmacokinetics of five-day oral administration of Deleobuvir (BI 207127), an investigational hepatitis C virus RNA polymerase inhibitor, in patients with chronic hepatitis C. Antimicrob Agents Chemother 2013, 57: 4727-4735. 10.1128/AAC.00565-13PubMedPubMed CentralView ArticleGoogle Scholar
  36. Hernandez D, Zhou N, Ueland J, Monikowski A, McPhee F: Natural prevalence of NS5A polymorphisms in subjects infected with hepatitis C virus genotype 3 and their effects on the antiviral activity of NS5A inhibitors. J Clin Virol 2013, 57: 13-18. 10.1016/j.jcv.2012.12.020PubMedView ArticleGoogle Scholar
  37. Lam AM, Espiritu C, Bansal S, Micolochick Steuer HM, Niu C, Zennou V, Keilman M, Zhu Y, Lan S, Otto MJ, Furman PA: Genotype and subtype profiling of PSI-7977 as a nucleotide inhibitor of hepatitis C virus. Antimicrob Agents Chemother 2012, 56: 3359-3368. 10.1128/AAC.00054-12PubMedPubMed CentralView ArticleGoogle Scholar

Copyright

© Paolucci et al.; licensee BioMed Central Ltd. 2013

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.