Skip to main content

Advertisement

Table 1 Amplification and sequencing primers for HCV NS5A and NS5B in genotypes 1a and 1b

From: Naturally occurring resistance mutations to inhibitors of HCV NS5A region and NS5B polymerase in DAA treatment-naïve patients

Gene Primer name Primer sequence
GT1a* NS5A HCV-1a NS5A Fwd out GACATCTGGGACTGGATATGYGA
  HCV-1a NS5A Rew out GTCCAGGWRTARGACATYGAGCA
  HCV-1a NS5A Fwd inn GATATGYGAGGTGYTGAGCGA
  HCV-1a NS5A Rew inn GAGCARCACACGACRTCYTC
  HCV-1a NS5A Rew Seq AAGGAGTCCARRATCACCAC
  HCV-1a NS5B Fwd out GGAGCCKGGRGATCCRGATCTYAGC
GT1a* NS5B HCV-1a NS5B Rew out GTTGGGGAGGAGGTAGATGCCTA
  HCV-1a NS5B Fwd inn GAYGTCGTGTGCTGCTCRATGTC
  HCV-1a NS5B Rew inn GAGACACGCTGTGATAAATGTCTCCC
  HCV-1a NS5B Fwd Seq TCGTAAGCCAGCTCGYCTCATCG
  HCV-1a NS5B Rew Seq CCTATTGATTTCACCTGGAGAG
  HCV-1b NS5A Fwd out GGATYAAYGARGACTGYTCYAC
  HCV-1b NS5A Rew out GACCARGACCCGTCRCTGAGRT
  HCV-1b NS5A Fwd inn GGGAYTGGATATGCACGGT
GT1b § NS5A HCV-1b NS5A Rew inn GGCATGGAGGARTAYGAC
  HCV-1b NS5A Fwd Seq ARTTGTCTGCGCCTTCYYTGAAGG
  HCV-1b NS5B Fwd out CGYTGAGTCRTAYTCCTCCATGC
  HCV-1b NS5B Rew out GGGCRCGAGACASGCTGTGATA
  HCV-1b NS5B Fwd inn CTCAGYGACGGGTCYTGGTC
GT1b § NS5B HCV-1b NS5B Rew inn GCTGTGATATATGTCTCCCC
  HCV-1b NS5B Fwd Seq2 TGGGRGTHCGYGTRTGCGAG
  HCV-1b NS5B Rew Seq3 AGCATYGTGCAGTCCYGGAGC
  1. *Genotype 1a; §Genotype 1b.