Fungal strains and culture condition

S. sclerotiorum strain AH16 was derived from a sclerotia collected from a diseased rapeseed stem in Anhui province, P.R. China. Strain Ep-1PNA367, a single-ascospore isolate derived from Ep-1PN. Ep-1PNA367R, a strain labeled with a hygromycin B phosphotransferase gene by an Agrobacterium tumefaciens mediated transformation method, shows no significant difference from its parent strain Ep-1PNA367 in biological properties, and was used as mycovirus transfection recipient strain. All the strains were cultured on potato dextrose agar (PDA) at 20–22 °C and stored at 4 °C.

RNA isolation and purification

To isolate dsRNA and total RNA from S. sclerotiorum strains, mycelia were cultured on PDA plate overlapping cellophane membranes for 3–4 days. The harvested mycelia were ground to fine powder in liquid nitrogen using sterilized mortar and pestle. dsRNA was extracted as previously described [17], and total RNA was extracted with TRIzol Reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. The dsRNA sample was treated with DNase I and S1 nuclease (Takara, Dalian, China), followed by separation by electrophoresis on a 1 % (wt/vol) agarose gel and purification with gel extraction kit (Axygene Biosciences). The gel-purified dsRNA fragments were subjected to sequence analysis. Total RNA was used for cDNA synthesis and PCR analysis.

Purification of virus particle

Isolation and purification of virus particle were performed as previously described with minor modifications [12, 18]. Briefly, mycelia of SsBRV2-infected strain and SsBRV2-free strain, respectively, were inoculated in conical flasks containing 150 ml PDB and shake-cultured at 200 rpm for 6 days. Next, mycelia were harvested through 4-layer sterilized gauze and then washed several times with sterilized water. After that, the harvested mycelia (30–40 g) were homogenized in the presence of 3 volume phosphate buffer (0.1 M sodium phosphate, pH 7.0, containing 0.2 M KCl and 0.5 % mercaptoethanol) in a Waring blender, followed by centrifugation at 10,000 rpm, 4 °C for 15 min to remove the hyphal cell debris. After two cycles of ultracentrifugation, virus particles were purified with a gradient sucrose concentration of 20–40 % (W/V) and then collected by a new sterile syringe. After ultracentrifugation to remove the sucrose solution, the virus particle pellets were re-suspended in 200 μl sodium phosphate buffer (0.1 M, pH7.0) and the concentration of the final 200 μl of virus particles was determined by spectrometry reading. dsRNA was isolated from the purified viral particles using phenol-chloroform extraction and detected on a 1 % agarose gel. The Structure proteins of the purified viral particles were separated on a 10 % (wt/vol) polyacrylamide gel amended with 1 % (wt/vol) sodium dodecyl sulfate (SDS).

For negative staining, a drop of about 5 μl of the purified virus particle suspension was loaded on the hydrophobic surface of a parafilm square. Several 200-mesh carbon-formvar coated copper grids were floated onto this drop for 5 min and the excess liquid was removed from each of the grids by touching its border with a cut piece of filter paper. Next, the grids loaded with virus particles were immediately re-floated in a drop of 2 % (W/V) phosphotungstic acid solution for 5 min, and the excess virus particle suspension was removed with filter paper and the prepared grids were left to dry for a few minutes. Finally, the prepared samples were visualized under transmission electron microscopy (TEM) as previously described [12].

Protoplast transfection and transfection assay

The virus-free strain Ep-1PNA367R was used as the recipient strain in the virus transfection experiment. Protoplasts from actively growing mycelia of strain Ep-1PNA367R were prepared as previously described [19]. The purified virus particles were introduced into the protoplasts of Ep-1PNA367R in the presence of polyethylene glycol (PEG) 4000 according to the protocol as previously reported [12]. All five candidate transfectants were further confirmed via dsRNA extraction and RT-PCR amplification with the specific primers for dsRNA1 of SsBRV2 (dsRNA1F: 5'-GCTCTACATCGCTACATTGGTTGG-3', dsRNA1R:5'-GGCTTGTTCATACTCGCACTCTTG-3'), dsRNA2 of SsBRV2 (dsRNA2F: 5'-GGAAAGAGAGCGCAGTGCATACG-3', dsRNA2R: 5'-CCATCCACCCCACCATACTCAG-3'), and mitovirus SsMV4/AH16 (F: 5'-AACAGACCGATTTCCGTTACAA-3' and R: 5'-TTCCACTTACTTCAATACCTCCCT-3').

cDNA cloning, sequencing and sequence analysis

The partial cDNA sequences of the dsRNA segments isolated from the strain AH16 were obtained as previously described [17, 20]. Terminal sequences were determined as previously described with minor modifications [21]. Briefly, 200–500 ng dsRNA and 30 pmol oligo nucleotide primer PC3-T7 loop (5’-p-GGATCCCGGGAATTCGGTAATACGACTCACTATATTTTTATAGTGAGTCGTATTA–OH-3′) were added into a reaction mixture [50 mM Tris-HCl (pH 7.5), MgCl2 10 mM, DTT 10 mM, 1 mM ATP, 20U RNase inhibitors, 25 % PEG4000 (W/V) and 40 units of T4 RNA ligase] and then ligated at 4–8 °C for 18 h. The ligated product was precipitated and centrifuged for purification. The pellets were re-suspended for cDNA synthesis using cDNA Synthesis Kit according to the manufacturer’s instructions (Fermentas). PCR amplification was performed using the PC2 primer (5’-p-CCGAATTCCCGGGATCC-3’) complementary to the oligonucleotide PC3-T7 loop and the sequence-specific primer corresponding to the 5’-and 3’-terminal sequences of the dsRNA, respectively. The full cDNA sequences of all dsRNA segments were further confirmed by RT-PCR amplification and PCR products were sequenced in two directions. To avoid artificial mistakes, every nucleotide was sequenced at least three times.

Assay of biological properties of mycovirus-infected and mycovirus-free strains

To define whether mycoviruses were responsible for phenotypic change between mycovirus-infected and mycovirus-free strains of S. sclerotiorum, the biological features including colony morphology, growth rate and virulence were evaluated. Colony development of individual strains was observed on PDA plates in succession and recorded separately with a camera at 3 days-post-inoculation (dpi), 7 dpi, and 15 dpi. To obtain the growth rate, all actively growing strains were cultured on fresh PDA plate and the diameter of colonies was measured separately at 24 and 48 h post-inoculation (hpi). The growth rate was then calculated using the method previously described [19]. The pathogenicity assay of S. sclerotiorum strains was performed on the detached soybean leaves as previously described [25]. All assays were repeated three times. Experimental data were analyzed by the SAS 8.0 program. Treatment means were compared using the least significant difference test at P = 0.05 level.

Visualization of three dsRNA segments in the strain AH16 of S. sclerotiorum

S. sclerotiorum strain AH16 shows abnormal phenotypes with less sclerotia and lower virulence on its host, which was similar to the phenotypes of other previously reported mycovirus-infected strains of S. sclerotiorum [26]. Thus we attempted to purify the virus-like particles (VLPs) with sucrose density gradient (20–40 %) centrifugation. The purified VLPs were further observed by TEM. Consistent with previous reports [11, 12, 27], VLPs were successfully extracted from the mycelia of the strain AH16. TEM observation suggested that these VLPs have morphological features of rigid spherical particles with a diameter of approximately 40 nm (Fig. 1a). Nucleic acids were extracted from these purified particles, showing that the purified VLPs accommodate a dsRNA segment (L-dsRNA) resistant to S1 nuclease and DNase I. When L-dsRNA elements were resolved on 5 % PAGE gel for 48 h, two similar sized L-dsRNA segments (L1-dsRNA and L2-dsRNA) were obviously separated (Fig. 1b, right figure), revealing that purified VLPs contain at least 2 dsRNA species, and strain AH16 is infected by one or more mycoviruses.

Previous studies reported that some mycoviruses (such as mitovirus and hypovirus) lack the true virion in their life cycles [28, 29]. To clarify whether strain AH16 harbors mycoviruses lacking the true virion, dsRNA and extra-chromosome DNA elements were directly extracted from the mycelia of strain AH16 using CF-11 cellulose chromatography and the CTAB method, respectively. Agarose electrophoresis and PAGE detection results indicated that three dsRNA segments (two L-dsRNA and one S-dsRNA) co-infected the strain AH16, but extra-chromosome DNA elements failed to be obtained. Two L-dsRNA segments from the mycelia had the same migration rate with that released from VLPs on agarose gel (Fig. 1b). Then, we subsequently demonstrated that the two L-dsRNA segments from the mycelia were associated with the purified VLPs, and further confirmed that they represented the genome of a new botybirnavirus (temporarily named Sclerotinia sclerotiorum botybirnavirus 2, SsBRV2/AH16), whereas S-dsRNA was the genome of a mitovirus (temporarily named Sclerotinia sclerotiorum mitovirus 4, SsMV4/AH16). Therefore, strain AH16 carries at least two mycoviruses, one with two dsRNA segments, the other with a single ssRNA segment.

The purified virus particles from SsBRV2-infected strain and SsBRV2-free strain, respectively, were further separated on SDS-PAGE gel-electrophoresed analysis (Fig. 1c). The results showed that four protein components with protein size of p100, p90, p70 and p60 were presence in SsBRV2-infected strain (lane VP), but lack in SsBRV2-free strain (lane VF). Therefore, SsBRV2 is comprised of four structure proteins.

SsMV4/AH16 is a new strain of Sclerotinia sclerotiorum mitovirus 4

The genetic organization of SsMV4/AH16 is shown in Fig. 2 and the complete nucleotide sequence of SsMV4/AH16 was deposited in the GenBank database under the accession number of KT962974. Similar to the size (~2.7 kb) estimated by agarose gel electrophoresis, the genome of SsMV4 comprises 2752 nucleotides with a low GC content of 31 %. The 5’ and 3’- UTRs are 471 and 85 nts long, respectively. SsMV4/AH16 contains a single ORF, and encodes a protein of RNA-dependent RNA polymerase (RdRp) when fungal mitochondrial code was applied (Fig. 2a). Multiple alignment and BLAST search revealed that SsMV4/AH16 RdRp shares high sequence identity (93 %) with a strain (SsMV4/NZ1) of Sclerotinia sclerotiorum mitovirus 4. Phylogenic analysis further supported that SsMV4/AH16 is closely related phylogenetically to members of the families Narnaviridae (Fig. 2b). Based on the ICTV rules of species demarcation criteria about mitovirus, strains of the same mitovirus species should share greater than 90 % identity with each other [28, 30]. Thus, SsMV4/AH16 and SsMV4/NZ1 belong to the same species (Sclerotinia sclerotiorum mitovirus 4) in genus Mitovirus. Previous reports proved that mitovirus is rich in diversity of strains in the population of S. sclerotiorum. Thus far, thirteen mitovirus strains belonging to seven mitovirus species (SsMV1 to SsMV7) have been characterized in S. sclerotiorum. SsMV1/KL-1 and SsMV2/KL-1 were isolated from a USA strain [17]. SsMV1/HC025 infected a Chinese strain [25]. Strains of SsMV2 to SsMV7 were discovered in New Zealand [31, 32]. Here, a new mitovirus strain SsMV4/AH16 was reported in China. These reports suggested that S. sclerotiorum isolates are commonly infected by mitoviruses regardless of their geographical origin.

SsBRV2, a bipartite dsRNA virus, is related phylogenetically to botybirnavirus

SsBRV2 has a bipartite genome consisting of L1-dsRNA and L2-dsRNA (Fig. 3). The complete genome of SsBRV2 was first determined using the method of tagged-random PCR. Fifty-eight random cDNA clones were obtained and randomly matched in different positions of two dsRNA segments. The gaps between different clones were generated by specific PCR, and terminal sequences of two dsRNA segments were determined from RACE clones. The full-length cDNA sequences of L1-dsRNA and L2-dsRNA were found to be 6159 and 5872 bp, respectively (Fig. 3), which were deposited in NCBI database under the accession numbers of KT962972 (for L1-dsRNA) and KT962973 (for L2-dsRNA).

ORFs were analyzed from the sequences of two segments, revealing that they were homologous to the corresponding segments of three other botybirnaviruses. ORF1, starting at nt position 413 and terminating at nt 6019, was identified on the positive strand of L1-dsRNA, and was deduced to encode a 1868-aa protein (209 kDa) (Fig. 3a). This deduced ORF1-encoded protein contains an RdRp (RdRp_4 superfamily, E-value = 1.9e-32) domain with eight conserved motifs (I to VIII) (Additional file 1: Figure. S1), which was similar to the RdRp sequences of the previous reports (11, 12). Multiple alignment based on the RdRp conserved domain revealed that SsBRV2 was phylogenetically related to previously reported SsBRV1 (46 % identities), SlaBRV1 (38 % identities), BpRV1 (55 % identities). The phylogenetic tree also indicated that SsBRV2 formed a well-supported clade with SsBRV1, SlaBRV1 and BpRV1, which was distant from other known dsRNA mycoviruses (Fig. 3b). ORF2 detected on the positive strand of L2-dsRNA codes for a putative 1778-aa protein with unknown functions (145 kDa) (Fig. 3a). Although no putative conserved domains were predicted in ORF2-encoded protein, the region (position from Gly184 to Arg1146) of the ORF2-encoded protein shares low sequence identity to the corresponding regions of SsBRV1 (27 %) and BpRV1 (25 %). Similar to other botybirnaviruses [11, 12], SsBRV2 has a long 5’-UTR but a relatively short 3’- UTR, and the terminal sequences of the two dsRNA segments of SsBRV2 are conserved with a sequence identity of 82.3 % (5’ terminal region) and 98.7 % (3’ terminal region) (Additional file 2: Figure. S2). The 5’-UTRs and 3’-UTRs of SsBRV2 were detected to form stable secondary structures with a ΔG value of −13.3 kcal/mol and −23.0 kcal/mol, respectively (Additional file 3: Figure S3).

The aforementioned results indicated that SsBRV2, the second botybirnavirus in S. sclerotiorum following the first reported botybirnavirus SsBRV1 in the strain SCH941 [12], is a novel bipartite dsRNA mycovirus belonging to the newly proposed family Botybirnaviridae. Although SsBRV1, SsBRV2, SlaBRV1, and BpRV1 are phylogenetically related with each other, there are five obvious differences among the four botybirnaviruses. First, three botybirnaviruses of SsBRV1, SsBRV2, and BpRV1 infect filamentous fungi [11, 12], whereas SlaBRV1 was detected from soybean phyllosphere via a metatranscriptomics technique and its complete genome was partially obtained [13]. Second, a satellite-RNA associated SsBRV1 was discovered in its fungal host [12], whereas no similar satellite-RNA was detected in SsBRV2-infected strains. Third, a GHBP domain (animal growth hormone receptor binding domain) was identified in SsBRV1 ORF2-encoded protein [12], which was not detected in that of SsBRV2 and BpRV1. Fourth, the first start codons (ATG) of ORF1 and ORF2 are located in the strictly conserved region of 5’ terminal of SsBRV2 and BpRV1 [11], whereas the strictly conserved region of SsBRV1 is located inside 5’-UTR [12]. Finally, SsBRV1 co-infected S. sclerotiorum strain SCH941 with an unpublished dsRNA mycovirus (a reovirus) [12], whereas SsBRV2 co-infected strain AH16 with a + ssRNA mycovirus (mitovirus). The phenomenon that a single strain was naturally co-infected by dsRNA and + ssRNA have not been reported in S. sclerotiorum.

SsBRV2 is associated with hypovirulence on S. sclerotiorum

To confirm whether SsBRV2 or/and SsMV4 is responsible for the hypovirulence of strain AH16, three approaches (virus horizontal transmission, protoplast regeneration isolation, and VLP transfection) were attempted as previously reported [12, 18]. Both mycoviruses (SsBRV2 or/and SsMV4) failed to transmit horizontally from strain AH16 to Ep-1PNA367R via hyphal contact, since strain AH16 is vegetatively incompatible with Ep-1PNA367R. To eliminate two mycoviruses from strain AH16, protoplasts were prepared and 38 protoplast regenerants were isolated. However, RT-PCR and dsRNA extraction confirmed that all the obtained protoplast regenerants still harbored two mycoviruses of SsBRV2 and SsMV4.

We successfully introduced the purified SsBRV2 VLPs into the virus-free strain Ep-1PNA367R of S. sclerotiorum and the transfectants of SsBRV2 were confirmed by repeated sub-culturing to be stable in phenotype and virus composition. One (Ep-1PNA367RVT) of the five transfectants were used for biological feature comparison. The results based on dsRNA extraction, or RT-PCR with the SsBRV2 and SsMV4-specific primers revealed that Ep-1PNA367RVT carries SsBRV2 but lacks SsMV4/AH16 (Fig. 4d). Compared to virus-free strain Ep-1PNA367R, strain AH16 has a slower growth rate (1.06 cm/d vs 2.24 cm/d) (Fig. 4c), and caused smaller lesions on detached soybean leaves (Fig. 4b). Strain Ep-1PNA367R formed sclerotia at 7dpi, whereas strain AH16 did not produce sclerotia at this time, and formed fewer, smaller sclerotia at 15 dpi. Interestingly, compared with strain AH16, Ep-1PNA367RVT showed more obvious hypovirulence phenotypic traits including lower growth rate, less virulence and no sclerotial production (Fig. 4a). Moreover, SsBRV2 could transmit from Ep-1PNA367RVT to virus-free strain Ep-1PNA367 and the newly SsBRV2-infected strain exhibited a subset of phenotypic traits similar to those of Ep-1PNA367RVT. Therefore, by transfecting virus-free S. sclerotiorum protoplasts with purified virus particles, we obtained unequivocal evidence that SsBRV2 confers hypovirulence to S. sclerotiorum.

VLPs transfection experiments suggested that BpRV1 was the causal agent of hypovirulence in Botrytis porri, whereas SsBRV1 without satellite-like RNA had latent infection in S. sclerotiorum [12]. Our present results indicated clearly that SsBRV2 is related to hypovirulence on S. sclerotiorum and they also revealed the diversity of the interactions between botybirnavirus and its host fungi. As for the question why Ep-1PNA367RVT infected with SsBRV2 alone exhibits more seriously debilitating symptoms than strain AH16 co-infected SsBRV2 and SsMV4, it could be answered from the following two aspects. First, the genetic background is different between strain Ep-1PNA367 and AH16, and the unknown interaction mechanism could be involved between SsBRV2 and the two different S. sclerotiorum strains. Secondly, similar to interference among unrelated RNA viruses in filamentous fungus Cryphonectria parasitica [33], the two unrelated mycoviruses of SsBRV2 and SsMV4 may undergo antagonistic interactions in a single isolate of S. sclerotiorum. A previous report suggested that SsMV4/NZ1 contributes a limited effect on the hypovirulence of S. sclerotiorum [31]. Whether SsMV4/AH16 is a contributor to phenotypic change of S. sclerotiorum needs to be further elucidated.