Open Access

Molecular characterization and phylogenetic analysis of the complete genome of a porcine sapovirus from Chinese swine

  • Shixing Yang1,
  • Wen Zhang2,
  • Quan Shen1,
  • Fen Huang1,
  • Yan Wang1,
  • Jianguo Zhu1,
  • Li Cui1,
  • Zhibiao Yang1 and
  • Xiuguo Hua1Email author
Contributed equally
Virology Journal20096:216

https://doi.org/10.1186/1743-422X-6-216

Received: 18 August 2009

Accepted: 6 December 2009

Published: 6 December 2009

Abstract

Background

Porcine sapovirus was first identified in the United States in 1980, hitherto, several Asian countries have detected this virus. In 2008, the first outbreak of gastroenteritis in piglets caused by porcine sapovirus in China was reported. The complete genome of the identified SaV strain Ch-sw-sav1 was sequenced and analyzed to provide gene profile for this outbreak.

Methods

The whole genome of Ch-sw-sav1 was amplified by RT-PCR and was sequenced. Sequence alignment of the complete genome or RNA dependent RNA polymerase (RdRp) gene was done. 3' end of ORF2 with 21-nt nucleotide insertion was further analyzed using software.

Results

Sequence analysis indicated that the genome of Ch-sw-sav1 was 7541 nucleotide long with two ORFs, excluding the 17 nucleotides ploy (A) at the 3' end. Phylogenetic analysis based on part of RdRp gene of this strain showed that it was classified into subgroup GIII. Sequence alignment indicated that there was an inserted 21-nt long nucleotide sequence at the 3' end of ORF2. The insertion showed high antigenicity index comparing to other regions in ORF2.

Conclusion

Ch-sw-sav1 shared similar genetic profile with an American PEC strain except the 21-nt nucleotide at the 3' end of ORF2. The insert sequence shared high identity with part gene of Sus scrofa clone RP44-484M10.

Background

Caliciviridae is a family of positive sense single-stranded RNA viruses comprised of both human and animal pathogens [1]. Caliciviridae family contains four genera, Lagovirus, Vesivirus, Norovirus and Sapovirus [2]. Various caliciviruses possess common features. For example, they are small, non-enveloped virus, 27-38 nm in diameter. They possess a single-stranded, 7.3-8.3 kb plus-sense RNA genome, a single 56-71 kD capsid protein [3], and a polyprotein containing confering motifs of a putative 2C helicase, 3C-like protease, and 3D RdRp. SaV are recognized as emerging enteric pathogens in humans, swine and mink [4]. SaV infection may cause diarrhea especially in the younger [5]. It is currently divided into eight distinct genetic groups (GI-GVIII) based on the RdRp gene. Among these genetic groups, GIII can't infect humans but can be cultured in vitro in the presence of bile acid [6]. The genome of SaV consists of 7.1-7.5 kb nucleotide and encodes two or three open reading frames (ORFs). ORF1 encodes one polyprotein that contains coding sequences for the nonstructural proteins and the major capsid protein (VP1), ORF2 encodes the minor structural protein (VP2), while ORF3 is only present in strains from genotypes GI, GIV and GV, and encodes a small basic protein [7]. SaV is considered as a significant global enteropathogen of acute gastroenteritis [8]. Recently, it was shown that the host tropism of some calicivirus is less specific. Some calicivirus may have zoonotic potential, and animals such as domestic pig may be a reservoir for caliciviruses [911]. Porcine sapovirus was first identified in the United States by electron microscopy in 1980 [12] and genetically characterized as a sapovirus in 1999 [13]. Recently, SaV infections have been identified in Japan, South Korea, Venezuela, Hungary and Belgium [1418]. In the United States, porcine sapovirus was also detected from Oyster [19]. Although porcine SaV was mainly detected in pigs, some studies indicated that some porcine SaV might be potential pathogencity transmitting to humans. For example, the porcine SaV strain (Sapovirus pig/43/06-18p3/06/ITA) isolated from Italy was most closely related to human SaV through the alignment of RdRp sequences, suggesting the possibility of a pig reservoir for human strains or vice versa [20]. We previously reported an outbreak of gastroenteritis in piglets in China caused by the first Chinese porcine SaV strain [21]. In this study, gene profile of this strain was investigated, the entire viral genome and 3' end of Ch-sw-sav1 were cloned and sequenced.

Methods

Samples

Porcine SaV positive fecal samples were collected from commercial pig farms in Shanghai as introduced in our previous study. Samples were converted to 20% (wt/vol) suspensions in phosphate-buffered saline (PBS) (0.01 M, pH 7.2 to 7.4) and clarified by centrifugation at 10,000 g for 10 min.

Primers Design

In order to amplify the full-length sequence, 15 sets of primers were designed based on the sequences of AF18276 and DQ056363 that were previously submitted in the GenBank: Nucleotide sequence and position of the primers are listed in Table 1.
Table 1

Nucleotide sequences of the oligonucleotides used for PCR amplification and sequencing

Primer set

Primer name

Nucleotide sequence

Position

1

SP1F

GTGATCGGTGATGGCTAATTGCCG

1-14

 

SP1R

TGGAGATGGTATCTGTCAGTGTG

645-667

2

SP2F

GGCAGTACATTTGTGAGGGGTG

543-564

 

SP2R

CCTGTTCTGCTTTATCACCTCC

1170-1191

3

SP3F

GACGGTGGCTGCCATTAAAGCTG

1063-1085

 

SP3R

GCAGTGTAGCCGCGTACTGAGC

1833-1854

4

SP4F

ATTGACGTGACAGCCCCCAC

1733-1752

 

SP4R

TGTGGTTCTTGACTGGTGAG

2335-2354

5

SP5F

TGGTGGAGGCCTGTTCAGAGC

2223-2243

 

SP5R

CCAAGTTGTGGGCTGTCAACAC

2757-2778

6

SP6F

CAGAGTCCTCCTGGTGGACATTC

2680-2702

 

SP6R

ATTACCAAGCGCAACGCTAGGC

3340-3361

7

SP7F

CATGTGGCCAACATGTGTG

3243-3261

 

SP7R

TGATTTGGTCAAGGTAGCC

3873-3891

8

SP8F

CCTTCTACAACACCAAATGATTGCC

3768-3792

 

SP8R

AGGCCAGGATGTCAACACTGGCAC

4371-4394

9

SP9F

ATGTATGGATAGCCCTCAGATTG

4261-4283

 

SP9R

GTCCACATCAACGGCCGCCGGCTCG

4890-4914

10

SP10F

AGCCAACAGACACTCCTGTGTTCC

4760-4783

 

SP10R

CATGCCAGACCCTGATATTATCACC

5468-5492

11

SP11F

ACCTACACCAATGTCACCTGGAC

5328-5350

 

SP11R

GTGCCACACCTACTATGACCACAG

5890-5913

12

SP12F

TCAAGCCTCCAAACCAAGCC

5784-5803

 

SP12R

TGGCGGTCCATAAATGAGGTG

6395-6415

13

SP13F

TATGCAGCTTTGGCAATTCCC

6291-6311

 

SP13R

TTGATCTTTAGCAACTGTATCTG

6892-6915

14

SP14F

TTGGATTGCAGGAGCAATGCAGG

6777-6799

 

SP14R

TGTAAGGTTCGGTACGCGTAACC

7280-7303

15

SP15F1

TCAATTGGCTGGGTCACGTGAAG

7027-7049

 

SP15F2

CAAACACCTTTGGTCCACCAAGG

7070-7092

RNA extraction and cDNA synthesis

Viral RNA was extracted with TRIzol Reagent from supernatants of fecal suspensions, according to the manufacture's instructions. The cDNA synthesis was primed by Oligo dT16 or the reverse one of each set of primers using TaKaRa RNA PCR kit (TaKaRa, Japan) in a 10 μL reaction volume. The reaction condition was 40 min at 42°C, then 15 sec at 86°C.

PCR and RACE amplifications of the full-length SaV genome

PCR was carried out in 50 μL reaction volume, containing 8 μL dNTP Mixture (25 mM), 5 μL 10×Ex-taq buffer, 0.2 μL Ex Taq, 1 μL (25 mM) of each primer, 10 μL of template and adding sterilize H2O to 50 μL. The reaction was done with the following profile: Activation of DNA polymerase at 95°C for 5 min, followed by 35 cycles of denaturation of DNA at 95°C for 40 sec, annealing at the 50°C for 1 min, extension at 72°C for 1 min and then followed by a final extension step at 72°C for 10 min. Purfied PCR products were ligated to pMD-18T vector (TaKaRa, Japan) and 3 to 5 positive colonies were sequenced.

3' RACE

The 3' RACE was carried out with TaKaRa RNA PCR Kit (TaKaRa, Japan) following the manufacture's instructions. Briefly, ten microliters of RNA were used as template to synthesize cDNA with AMV Reverse transcriptase for 1 h at 42°C. The external reverse primer which has a poly (T) tract was used to prime the cDNA synthesis. The cDNA was then amplified with the external forward primer (5'-TCAATTGGCTGGG TCACGTGAAG-3', nucleotide position numbers 7027-7049) and internal forward primer (5'- CAAACACCTTTGGTCCACCAAGG-3', nucleotide position numbers 7070-7092) with Ex Taq DNA polymerase (TaKaRa, Japan). The PCR reaction mixture was incubated for 2 min at 94°C, followed by 35 amplification cycles comprising denaturation at 94°C for 30 s, annealing at 65°C for 30 s, and extension at 72°C for 30 s. The product was extended for another 7 min at 72°C to ensure a full extension.

The PCR products were purified from 1% agarose gel using the QIAquick Gel Extraction kit (Qiagen, Gemany). Purified PCR products were ligated into pMD18-T Vector. For each product, three to five positive colonies were selected and sequenced.

Phylogenetic analysis

Nucleotide sequences of the following calicivirus in Genbank were used in the phylogenic analysis (Table 2): SVs: Sapovirus Mc10/Japan (NC_010624), Sapovirus C12/Japan (AY603425), Sapovirus SaKaeo-15/Thailand (AY646855), Sapovirus Mc2/Japan (AY237419), Sapovirus Ehime1107/2002/JP(DQ058829), Sapovirus Mc114/Japan (AY237422), Sapovirus Hu/Dresden/pJG-Sap01/DE (AY694184), Sapovirus NongKhai-24/Thailand (AY646856), and Porcine enteric sapovirus/USA (AF182760); NVs: Norovirus mouse/Hannover1/2007/DEU (EU854589), Norwalk virus/USA (NC001959), Norwalk virus/Germany (AF093797), Norovirus Hu/GI/Otofuke/1979/JP (AB187514), Bovine calicivirus/UK (AJ011099), Bo/Dumfries/94/UK (AY126474), Human calicivirus strain Mc37/Japan (AY237415), Norwalk-like virus/Gifu'96/Japan (AB045603), Hawaii calicivirus/USA (HCU07611), Lordsdale virus (X86557), Norovirus Hu/GII-4/Hokkaido1/2006/JP (AB447427), Norovirus Hu/Houston/TCH186/2002/US (EU310927), Norovirus Hu/NLV/Oxford/B4S4/2002/UK (AY587986); VVs: FCV (M86379) and SMSV1 (SMU15301); LVs: RHDV (M67473) and EBHSV (Z69620). Sequencing reads from each PCR product were assembled using SeqMan II program (DNASTAR, Inc). Multiple sequence alignment was performed using CLUSTAL W method. The nucleotide identity and nucleotide divergence between complete Porcine SaV genomes was calculated using MegAlign program (DNASTAR, Inc). MEGA software was used to construct a phylogenetic tree, the reliability of the generated tree was evaluated by bootstrapping 1000 replicates. The same process was applied to analyse part of RNA dependent RNA polymerase genes, Nucleotide sequences of the following calicivirus in Genbank were used in the phylogenic analysis: Sapovirus Hu/Lyon/30338/98/F (AJ251991), Sapporo virus-Manchester (X86560), Sapporo virus-Houston/86 (U95643), Sapovirus Hu/Ehime/2K-814/2000 (AJ606698), Sapovirus Hu/Potsdam/2000/DEU (AF294739), Sapovirus Hu/Mex14917/2000 (AF435813), Sapovirus Hu/Hou7-1181 (AF435814), Sapovirus Hu/Ehime/99-1596/1999/JP (AJ606697), Sapovirus Hu/Ehime/01-1669/2001 (AJ606699), Sapovirus Hu/Arg39/1995/ARG (AY289803), Sapovirus pig/43/06-18p3/06/ITA (EU221477), Sapovirus Hu/Chiba/991172/1999 (AJ606691), Sapovirus Hu/cruise ship/2000/USA (AY289804), Sapovirus Hu/Bristol/1998/UK (AJ249939), Sapporo virus-London/29845 (U95645), Po/SaV/Giessen-08/2003/DE (EU122248), Po/SaV/Giessen-07/2004/DE (EU122246), Porcine enteric sapovirus swine/YiY1/2006/PRC (EU381231), Porcine enteric sapovirus/Venezuelan (DQ056363), Sapovirus swine/OH-JJ259/00/US (AY826423), Porcine enteric sapovirus/Japan (AB242875), Sapovirus swine/OH-MM280/03/US (AY823308), Sapovirus swine/NC-QW270/03/US (AY826426), PEC/swine-Id3/2005/HUN (DQ383274), Porcine enteric sapovirus/K8/JP (AB242873), Sapovirus Po/2053P4/Brazil (DQ359100), Sapovirus Po/OH-JJ681/2000/US (AY974192), Sapovirus Po/2014P2/Brazil (DQ359099), Sapovirus Po/OH-LL26/2002/US (AY974195), Porcine enteric sapovirus/K7/JP (AB221130). The sequence determined in current study was deposited in GenBank, the name was Ch-sw-sav1 and the accession number was FJ387164.
Table 2

Summary of sapovirus strains and representative strains for Lagovirus, Vesivirus, and Norovirus genera and NB-like viruses used in sequence analysis

Strains

Genus/genogroup

GenBank accession no.

Sapovirus Mc10/Japan

SaV/GII

NC_010624

Sapovirus C12/Japan

SaV/GII

AY603425

Sapovirus SaKaeo-15/Thailand

SaV/GII

AY646855

Sapovirus Mc2/Japan

SaV/GII

AY237419

Sapovirus Ehime1107/2002/JP

SaV/GII

DQ058829

Sapovirus Mc114/Japan

SaV/GI

AY237422

Sapovirus Hu/Dresden/pJG-Sap01/DE

SaV/GI

AY694184

Sapovirus NongKhai-24/Thailand

SaV/GV

AY646856

Porcine enteric sapovirus/USA

SaV/GIII

AF182760

Norovirus mouse/Hannover1/2007/DEU

Mouse NoV

EU854589

Norwalk virus/USA

NoV/GI

NC001959

Norwalk virus/Germany

NoV/GI

AF093797

Norovirus Hu/GI/Otofuke/1979/JP

NoV/GI

AB187514

Bovine calicivirus/UK

Bovine calicivirus

AJ011099

Bo/Dumfries/94/UK

Bovine calicivirus

AY126474

Human calicivirus strain Mc37/Japan

NoV/GII

AY237415

Norwalk-like virus/Gifu'96/Japan

NoV/GII

AB045603

Hawaii calicivirus/USA

NoV/GII

HCU07611

Lordsdale virus

NoV/GII

X86557

Norovirus Hu/GII-4/Hokkaido1/2006/JP

NoV/GII

AB447427

Norovirus Hu/Houston/TCH186/2002/US

NoV/GII

EU310927

Norovirus Hu/NLV/Oxford/B4S4/2002/UK

NoV/GII

AY587986

Feline calicivirus

FCV

M86379

San Miguel sea lion virus serotype 1

SMSV1

SMU15301

European brown hare syndrome virus

RHDV

M67473

European brown hare syndrome virus

EBHSV

Z69620

3' end of ORF2 partial sequences analysis

Six available Porcine SaVs partial sequences of 3' end of ORF2 were retrieved from GenBank, according to sequence alignment. As follows: OH-MM-280-03-US (AY823308), PEC-USA (AF182760), strain LL14 (AY425671), OH-JJ-259-00-US (AY826423), NC-QW-270-03-US (AY826426). Nucleotide sequence and protein were aligned by CLUSTAL W method using DNAstar software, antigen index was analysed by protean using DNAstar software.

Results

Genomic organization of Ch-sw-sav1 virus

The complete RNA genome of Ch-sw-sav1 is consisted of 7541 nt, excluding its 3' end poly(A) tail, was longer than the USA strain (GenBank no.: AF182760). It's A, C, G, U ribonucleotide composition was 19%, 14.3%, 33.3%, and 33.3%, respectively. The 5' terminus genomic RNA started with the featured trinucleotide GTG. Similar to the genomes of SVs and LVs, the Ch-sw-sav1 genome contained two predicted ORFs. ORF1 was 6765 bases (2255 aa) in length encoding non-structural proteins and VP1 (544aa). ORF2, consisting of 516 bases (nt 6771-7286), was predicted to encode VP2 protein with 172 aa. (Fig. 1A). The predicted polyprotein encoded by ORF1 contained the common 2C helicase (GPPGIGKT), 3C protease (GDCG), and RdRp (GLPSG and YGDD) motifs that were highly conserved in all calicivirus. The PPG motif was also present in the predicted VP1 (data not shown).
Figure 1

Genomic characteristic of Ch-sw-sav1. A. Schematic of the genomic organization of Ch-sw-sav1 showing the two predicted ORFs: ORF1, encoding a polyprotein fused to and contiguous with the capsid protein (VP1), forming a large polyprotein; and ORF2 encoding a small basic protein (VP2) of unknown function. B. Schematic of the conserved nucleotide sequence motifs at the 5' termini of the genomic and predicted subgenomic RNAs. The Kozak context, favorable for translation initiation, is underlined. C. Aligned nucleotide and predicted amino acid sequences at the junction between ORF1 and ORF2. ORF2 overlaps the 3' end of ORF1 by 4nt (underlined).

Sequence comparison

We compared the entire genome sequence identities of Ch-sw-sav1 with those of other calicivirus, A phylogenetic tree based on the entire genome sequence showed that Ch-sw-sav1 was closely related to the SLVs than to the other caliciviruses (Fig. 2). The phylogenetic tree was then constructed on the basis of concentrated alignments of RNA dependent RNA polymerase gene sequence of 31 SaV strains by the neighbour-joining method (Fig. 3). All eight genotypes were separated into corresponding lineages. Within the genotype-3 lineage, there were four distinct subgroups. The analysis indicated that Ch-sw-sav1 formed a subgroup together with two USA strains, one Japanese strain and one Hungary strain. Further analysis indicated Ch-sw-sav1 shared 82.2%-91.2% identities with the other GIII SaV strains, and it was closely related to the Hungary variant DQ383274 (Table 3). Whereas, it was less similar (< 57.1%) to the strains of GI, GII, GIV, GV, GVI, GVII, GVIII.
Table 3

Percentages of nucleotide sequence identity of Ch-sw-sav1 with other caliciviruses in regions aligned for phylogeny

Strain

Genogroupe

GenBank accession no.

% Identity

Hu/Lyon/30338/98/F

GI

AJ251991

47.7

Sapporo virus-Manchester

GI

X86560

42.7

Sapporo virus-Houston/86

GI

U95643

48.5

Hu/Ehime/2K-814/2000

GI

AJ606698

40.3

Hu/Potsdam/2000/DEU

GI

AF294739

57.1

Hu/Mex14917/2000

GI

AF435813

40.4

Hu/Hou7-1181

GIV

AF435814

50.3

Hu/Ehime/99-1596/1999/JP

GIV

AJ606697

45.5

Hu/Ehime/01-1669/2001

GV

AJ606699

43.8

Hu/Arg39/1995/ARG

GV

AY289803

42.1

pig/43/06-18p3/06/ITA

GVIII?

EU221477

29.0

Hu/Chiba/991172/1999

GII

AJ606691

40.0

Hu/cruise ship/2000/USA

GII

AY289804

22.9

Hu/Bristol/1998/UK

GII

AJ249939

43.2

Sapporo virus-London/29845

GII

U95645

47.2

Po/SaV/Giessen-08/2003/DE

GIII

EU122248

88.4

Po/SaV/Giessen-07/2004/DE

GIII

EU122246

86.1

swine/YiY1/2006/PRC

GIII

EU381231

84.2

Porcine sapovirus/Venezuelan

GIII

DQ056363

86.1

swine/OH-JJ259/00/US

GIII

AY826423

86.1

Porcine enteric sapovirus/Japan

GIII

AB242875

84.5

swine/OH-MM280/03/US

GIII

AY823308

82.2

swine/NC-QW270/03/US

GIII

AY826426

86.7

PEC/swine-Id3/2005/HUN

GIII

DQ383274

91.2

Porcine enteric sapovirus/K8/JP

GVI

AB242873

20.2

Po/2053P4/Brazil

GVI

DQ359100

18.6

Po/OH-JJ681/2000/US

GVI

AY974192

28.3

Po/2014P2/Brazil

GVI

DQ359099

16.3

Po/OH-LL26/2002/US

GVII

AY974195

29.2

Porcine enteric sapovirus/K7/JP

GVII

AB221130

18.4

Figure 2

Phylogenetic tree generated for the sequences in the complete genome. Phylogenetic tree constructed on the basis of the complete genome sequence. All sequences were collected from GenBank. The virus detected in this study was marked with black triangle. Trees were prepared using the Treeview programs and all branches supported based on 100 bootstrapped data sets.

Figure 3

Unrooted phylogenetic tree of calicivirus RdRp gene sequences constructed by the neighbor-joining method. Phylogenetic tree constructed on the basis of concentrated RdRp gene sequence. Trees were prepared using the Treeview programs and are based on 100 bootstrapped data sets. All sequence used in this analysis were collected from GenBank. The virus detected in this study was marked with black triangle and it was composed of a cluster with PEC/swine-Id3/2005/HUN and Sapovirus swine/NC- QW270/03/US, they also belong to porcine SaV genotype GIII.

The 5' terminus of the genomic and predicted subgenomic RNAs of Ch-sw-sav1 possessed leader sequences with a Kozak structure (G/ANNATGG), which was favourable for translation initiation of eukaryotic mRNA [22] (Fig. 1B), similar to that of PEC (GenBank No.: AF182760) [13], The VP1 region (544aa) of Ch-sw-sav1 was the same in length as in PEC and slightly shorter than those of SaVs of human origin. The ORF2 overlapped 4 nucleotides with VP1 gene, common to others in PEC (Fig. 1C), but the length of ORF2 was distinct. Sequence alignment based on the 3' end of ORF2 of six available sequences in GenBank indicated that there was 21-nt long nucleotide sequence insertion, which was similar to the gene module of OH-JJ-259-00-US strain (GenBank No.: AY826423) with 27-nt long nucleotides inserted (Fig. 4). Analysis of antigen index showed that the inserted sequence was within the affluent antigen site besides another at the 3' end of ORF2 (Fig. 5).
Figure 4

Nucleotide acid alignment of 3' end sequences of VP2 among six porcine SaV strains. The numbers above the alignment show the nucleotide location in the ORF2. The nucleotide with the white background is differential. The inserted sequence of Ch-sw-sav1 is from 27-nt to 46-nt

Figure 5

Antigen index analysis of 3' end sequences of VP2 among six porcine SaV strains. Antigen index is analysed by protean using DNAstar software. The regions marked by scale are the site of inserted sequence.

Discussion

Sapporo virus was identified in 1982 from an outbreak of diarrhea in an orphanage in Sapporo, Japan [23]. Schuffenecker [24] classified them into three major genetic groups. Furthermore, it has been divided into eight genogroups based on the genetic diversity of the viral polymerase [25]. PEC, the first of pig origin, was discovered in 1980s in the United States and belongs to SaV GIII [12]. Hitherto, SaV has been identified in many countries [1418]. Traditionally, we thought only SaV GIII infected pig. However, strains detected in USA and Italy that belonged to new genotype showed high homology with human SaVs respectively. It indicated that animals might act as reservoirs for human caliciviruses. So it is necessary to analyze the genetic profile of porcine SaV for the first step of controlling the pathogen. In February 2008, we reported the first outbreak of gastroenteritis caused by porcine SaV in piglets in China mainland. It may be caused by simultaneous contact with virus polluted water or food and the virus gene profile was further investegated. Ch-sw-sav1 was chosen to be sequenced and compared with other SaV published. Results showed that it shared high homology with PEC for the similar gene structure and similar sequence motif at 5' terminus that was favorable for translation initiation of eukaryotic sequence [22]. However, there was 21-nt nucleotide insertion at the 3' end of ORF2 of Ch-sw-sav1. The inserted sequence had a high antigenicity index analyzed with DNAstar software. It's predicted that ORF2 encodes capsid protein that is correlative with the assembly, antigenicity and receptor interations of SaV. So the inserted sequence may affect antigenicity profile or other profiles of capsid protein which need to be further identified [1]. Accordingly, in phylogenetic analysis, we classified Ch-sw-sav1 into Genogroup III of SaV basing on the partial RdRp gene sequence, and it shared highest nucleotide identity with the Hungary SaV (91.2%) which was isolated from a diarrheaed pig [17].

The porcine SaV strain in the present study came from an outbreak of gastroenteritis in piglets group, which had inserted sequence at the 3' end of ORF2. The role of the inserted sequence was unknown, but it is highly divergent in sequence and differs in size in caliciviruse s. Since the ORF2 protein is functionally conserved and may be involved in protein-protein interactions or protein-nucleic acid interactions during replication based on its strong positive charge. The inserted sequence likely has special biological function. So establishing full-length infectious clones containing or not containing this inserted fragment would now be the next step towards the identification of this fragment involved in symptomatology and pathogenicity.

Conclusion

Complete sequence of the first Chinese porcine SaV was determined and analyzed providing a gene profile of porcine SaV presented in swine population in China today. Sequence analysis showed that it was classified into genogroup III with two ORFs. A 21-nt insertion in ORF2 changed antigenicity index of capsid protein.

Notes

Declarations

Acknowledgements

This work was supported by Key Project of Shanghai Science and Techology Committee of China under Grant No.063919121.

Authors’ Affiliations

(1)
School of Agriculture and Biology, Shanghai Jiao Tong University
(2)
School of Medical Science and Laboratory Medicine, Jiangsu University

References

  1. Chen R, Neill JD, Estes MK, Prasad BV: X-ray structure of a native calicivirus: structural insights into antigenic diversity and host specificity. Proc Natl Acad Sci USA 2007,103(21):8048-8053. 10.1073/pnas.0600421103View ArticleGoogle Scholar
  2. Fullerton SW, Blaschke M, Coutard B, Gebhardt J, Gorbalenya A, Canard B, Tucker PA, Rohayem J: Structural and Functional Characterization of Sapovirus RNA-Dependent RNA Polymerase. J Virol 2007,81(4):1858-1871. 10.1128/JVI.01462-06PubMed CentralView ArticlePubMedGoogle Scholar
  3. Bajolet O, Chippaux-Hyppolite C: Rotavirus and other viruses of diarrhea. Bull Soc Pathol Exot 1998,91(5 Pt 1-2):432-437.PubMedGoogle Scholar
  4. Guo M, Evermann JF, Saif LJ: Detection and molecular characterization of cultivable caliciviruses from clinically normal mink and enteric caliciviruses associated with diarrhea in mink. Arch Virol 2001,146(3):479-493. 10.1007/s007050170157View ArticlePubMedGoogle Scholar
  5. Hansman GS, Oka T, Sakon N, Takeda N: Antigenic Diversity of Human Sapoviruses. Emerg Infect Dis 2007,13(10):1519-1525.PubMed CentralView ArticlePubMedGoogle Scholar
  6. Chang KO, Sosnovtsev SV, Belliot G, Kim Y, Saif LJ, Green KY: Bile acids are essential for porcine enteric calicivirus replication in association with down- regulation of signal transducer and activator of transcription. Proc Natl Acad Sci USA 2004,101(23):8733-8738. 10.1073/pnas.0401126101PubMed CentralView ArticlePubMedGoogle Scholar
  7. Farkas T, Zhong WM, Jing Y, Huang PW, Espinosa SM, Martinez N, Morrow AL, Ruiz-Palacios GM, Pickering LK, Jiang X: Genetic diversity among sapoviruses. Arch Virol 2004,149(7):1309-1323. 10.1007/s00705-004-0296-9View ArticlePubMedGoogle Scholar
  8. Parashar UD, Hummelman EG, Bresee JS, Miller MA, Glass RI: Global illness and deaths caused by rotavirus disease in children. Emerg Infect Dis 2003,9(5):565-572.PubMed CentralView ArticlePubMedGoogle Scholar
  9. Farkas T, Nakajima S, Sugieda M, Deng A, Zhong W, Jiang X: Seroprevalence of noroviruses in swine. J Clin Microbiol 2005,43(2):657-661. 10.1128/JCM.43.2.657-661.2005PubMed CentralView ArticlePubMedGoogle Scholar
  10. Smith AW, Iversen PL, Skilling DE, Stein DA, Bok K, Matson DO: Vesivirus viremia and seroprevalencein humans. J Med Viro 2006,78(5):693-701. 10.1002/jmv.20594View ArticleGoogle Scholar
  11. Wang Q-H, Han MG, Cheetham S, Souza M, Funk JA, Saif LJ: Porcine noroviruses related to human noroviruses. Emerg Infect Dis 2005,11(12):1874-1881.PubMed CentralView ArticlePubMedGoogle Scholar
  12. Saif LJ, Bohl EH, Theil KW, Cross RF, House JA: Rotavirus-like, calicivirus-like, and 23-nm virus-like particles associated with diarrhea in young pigs. J Clin Microbiol 1980,12(1):105-111.PubMed CentralPubMedGoogle Scholar
  13. Guo M, Chang KO, Hardy ME, Zhang Q, Parwani AV, Saif LJ: Molecular characterization of a porcine enteric calicivirus genetically related to Sapporo-like human caliciviruses. J Virol 1999,73(11):9625-9631.PubMed CentralPubMedGoogle Scholar
  14. Jeong C, Park SI, Park SH, Kim HH, Park SJ, Jeong JH, Choy HE, Saif LJ, Kim SK, Kang MI, Hyun BH, Cho KO: Genetic Diversity of Porcine Sapoviruses. Vet Microbiol 2007,122(3-4):246-257. 10.1016/j.vetmic.2007.02.008View ArticlePubMedGoogle Scholar
  15. Kim HJ, Cho HS, Cho KO, Park NY: Detection and molecular characterization of porcine enteric calicivirus in Korea, genetically related to Sapovirus. J Vet Med B Infect Dis Vet Public Health 2006,53(4):155-159.View ArticlePubMedGoogle Scholar
  16. Martinez MA, Alcala AC, Carruyo G, Botero L, Liprandi F, Ludert JE: Molecular detection of porcine enteric caliciviruses in Venezuelan farms. Vet Microbiol 2006,116(1-3):77-84. 10.1016/j.vetmic.2006.03.016View ArticlePubMedGoogle Scholar
  17. Reuter G, Bíró H, Szucs G: Enteric caliciviruses in domestic pigs in Hungary. Arch Virol 2007,152(3):611-614. 10.1007/s00705-006-0887-8View ArticlePubMedGoogle Scholar
  18. Mauroy A, Scipioni A, Mathijs E, Miry C, Ziant D, Thys C, Thiry E: Noroviruses and sapoviruses in pigs in Belgium. Arch Virol 2008,153(10):1927-31. 10.1007/s00705-008-0189-4View ArticlePubMedGoogle Scholar
  19. Costantini V, Loisy F, Joens L, Le Guyader FS, Saif LJ: Human and Animal Enteric Caliciviruses in Oysters from Different Coastal Regions of the United States. Appl Environ Microbiol 2006,72(3):1800-1809. 10.1128/AEM.72.3.1800-1809.2006PubMed CentralView ArticlePubMedGoogle Scholar
  20. Martella V, Lorusso E, Banyai K, Decaro N, Corrente M, Elia G, Cavalli A, Radogna A, Costantini V, Saif LJ, Lavazza A, Di Trani L, Buonavoglia C, Cavalli A, Radogna A, Costantini V, Saif LJ, Lavazza A, Di Trani L, Buonavoglia C: Identification of a Porcine Calicivirus Related Genetically to Human Sapoviruses. J Clin Microbiol 2008,46(6):1907-1913. 10.1128/JCM.00341-08PubMed CentralView ArticlePubMedGoogle Scholar
  21. Zhang W, Shen Q, Hua X, Cui L, Liu J, Yang S: The first Chinese porcine sapovirus strain that contributed to an outbreak of gastroenteritis in piglets. J Virol 2008,82(16):8239-8240. 10.1128/JVI.01020-08PubMed CentralView ArticlePubMedGoogle Scholar
  22. Kozak M: Structural features in eukaryotic mRNAs that modulate the initiation of translation. J Biol Chem 22,266(30):19867-19870.Google Scholar
  23. Nakata S, Chiba S, Terashima H, Sakuma Y, Kogasaka R, Nakao T: Microtiter solidphase radioimmunoassay for detection of human calicivirus in stools. J Clin Microbiol 1983,17(2):198-201.PubMed CentralPubMedGoogle Scholar
  24. Schuffenecker I, Ando T, Thouvenot D, Lina B, Aymard M: Genetic classification of "Sapporo-like viruses". Arch Virol 2001,146(11):2115-2132. 10.1007/s007050170024View ArticlePubMedGoogle Scholar
  25. Martella V, Lorusso E, Banyai K, Decaro N, Corrente M, Elia G, Cavalli A, Radogna A, Costantini V, Saif LJ, Lavazza A, Di Trani L, Buonavoglia C: Identification of a Porcine Calicivirus Related Genetically to Human Sapoviruses. J Clin Microbiol 2008,46(6):1907-1913. 10.1128/JCM.00341-08PubMed CentralView ArticlePubMedGoogle Scholar

Copyright

© Yang et al; licensee BioMed Central Ltd. 2009

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement