Open Access

High resolution melting analysis: rapid and precise characterisation of recombinant influenza A genomes

Virology Journal201310:284

https://doi.org/10.1186/1743-422X-10-284

Received: 7 May 2013

Accepted: 9 September 2013

Published: 12 September 2013

Abstract

Background

High resolution melting analysis (HRM) is a rapid and cost-effective technique for the characterisation of PCR amplicons. Because the reverse genetics of segmented influenza A viruses allows the generation of numerous influenza A virus reassortants within a short time, methods for the rapid selection of the correct recombinants are very useful.

Methods

PCR primer pairs covering the single nucleotide polymorphism (SNP) positions of two different influenza A H5N1 strains were designed. Reassortants of the two different H5N1 isolates were used as a model to prove the suitability of HRM for the selection of the correct recombinants. Furthermore, two different cycler instruments were compared.

Results

Both cycler instruments generated comparable average melting peaks, which allowed the easy identification and selection of the correct cloned segments or reassorted viruses.

Conclusions

HRM is a highly suitable method for the rapid and precise characterisation of cloned influenza A genomes.

Keywords

Influenza a virus Highly pathogenic avian influenza virus High resolution melting analysis

Background

Influenza A viruses (IAV) are pathogens of major importance in both public health and veterinary medicine and have a high socio-economic impact. Research has generated a substantial increase in our knowledge of influenza viruses in recent years. A technique that has revolutionised influenza research is plasmid-based reverse genetics, which enables the generation of custom-designed recombinant viruses [1, 2]. Routine cloning procedures are the standard for manipulating the viral genome and thus facilitate basic and applied research. The comparative segment exchange between different influenza virus strains with plasmid-based sequences and the subsequent generation of designed influenza virus reassortants is a major research technique because it facilitates studies on many topics, such as the molecular basis of IAV pathogenesis.

To date, the sequencing of cloned influenza segment plasmids and generated reassortant viruses has been necessary to confirm the successful implementation of sequence mutations. However, novel versatile technologies for the rapid and precise detection of mutations or single nucleotide polymorphisms (SNP) are currently available. In this study, we describe the application of “High-Resolution Melt (HRM) Analysis” for the verification of newly generated IAV reassortants (with mutations in a single segment) as an exemplary practical approach.

The principle of HRM analysis is based on the melting (dissociation) behaviour of DNA as it changes its transition from double- to single-strand status in the presence of a saturating fluorescent DNA-binding dye [3]. Melting analysis detects differences in the PCR amplicons that depend on the length, base composition, and strand base pairing of the amplicon. Genotyping, microbial detection, and species identification are the main fields in current HRM analysis [48]. Diagnostic strategies using HRM analysis have also been developed for influenza A subtyping and the detection of resistance to neuraminidase inhibitors from human samples [913].

Our study focused on the identification of influenza A viruses that were generated in vitro using a reverse genetics technology [14] through HRM analysis.

Results and discussion

Figure 1 shows a comparison of the average melting peaks of the individual RNA segments of both influenza virus strains. The most distinct melting peaks were obtained for those segments with three SNPs (two cytosines and one guanine), whereas the corresponding sequence consisted of adenine and thymines, such as that obtained for segments 3 and 6 (Figure 1 and Table 1). However, as few as two SNPs within a sequence resulted in an explicit differentiation of 0.88°C and 0.9°C, e.g., as obtained for segment 7 (Figure 1 and Table 1). The smallest melting peak differences were obtained for segments 2 and 8 (values < 0.49/0.6, Figure 1), which exhibited four SNPs consisting of three cytosines/guanines and one adenine/thymine in one sequence compared with three adenines/thymines and one cytosine/guanine in the other sequence. Therefore, the SNP length is less pivotal than the SNP composition for the generation of large differences between the melting peaks of two segment sequences.
Figure 1

Melting peaks detected by HRM analyses of eight segments of two closely related HPAIV strains. The numerical difference between the melting peaks is indicated above the columns. (A) Melting peaks detected using the Light Cycler system. (B) Melting peaks detected using the Eco Cycler system. The values represent the average of the eight RNA preparations tested. The error bars indicate the standard deviation.

Table 1

Virus segment-specific PCR primers and corresponding SNPs

 

Designation

Sequence 5‘→3’

Amplicon length (bp)

No. of SNP

SNPs in R65 (top row) versus R1959 (bottom row) = *

Segment 1 (PB2)

R65-PB2-1648Fw

GGTCCTGAGTCAGTGCTTG

94

4

GAAT

R65–PB2-1742Rv

CGGTTCAAACTCCATCTTATTGT

  

ACGG

Segment 2 (PB1)

R65-PB1-1524Fw

ATTTGTAGCCAATTTCAGTATGGA

128

4

CAGG

R65-PB1-1652Rv

TGAAGAGCCATCTGAGCTG

  

TGTA

Segment 3 (PA)

R65-PA-1547Fw

GATCCCACTTGAGGAATGATAC

78

3

TTA

R65-PA-1625Rv

CAGTACTTTTCCCACTTGTGTG

  

CCG

Segment 4 (HA)

R65-HA 204Fw

ATCTAGAYGGAGTGAAGCCTC

85

3

GCC

R65-HA 289Rv

TAAGACCATTCCGGCACATTG

  

ATT

Segment 5 (NP)

R65-NP-355Fw

TGGGTGAGAGAGCTGATTCTGTACG

113

3

ATT

R65-NP-468Rv

TGGAATGCCATATCATCAGGTG

  

GCC

Segment 6 (NA)

R65-NA-1156Fw

GGTCAGGATATAGCGGGAG

84

3

CGC

R65-NA-1240Rv

ATTAACTCAACCCAGAAACAAGG

  

TAT

Segment 7 (M)

R65-M-119Fw

TTTGCAGGAAAGAACACCGATC

93

2

CC

R65-M-212Rv

CAAATCCCAACATCCCTTTAGTC

  

TT

Segment 8 (NS)

R65-NS1-224Fw

GCGAATTCTGGAGGAGGAG

112

4

CACC

R65-NS1-336Rv

AAGGGAACCTGTCACTTTCTG

  

TGAT

In total, 18 different viruses were engineered by reverse genetics (two ancestor viruses, eight viruses consisting of seven segments from strain R65 and one segment from strain R1959, and eight viruses consisting of seven segments from R1959 and one segment from R65). The RNA preparations of these 18 viruses were tested on both cycler systems, and all eight segments of each virus were evaluated. All of the virus strains were correctly identified using both cycler systems (Additional file 1: Table S1).

The average melting peaks detected by the Eco cycler system did not differ by more than 0.3°C from the average melting peaks detected with the Light cycler system. However, the melting peaks detected with the Light cycler system exhibited lower standard deviations compared with those obtained with the Eco cycler system. Nevertheless, the average differences between the melting peaks of the individual influenza segments obtained with both cycler systems exhibited very similar values (Figure 1). Although the classical approach used for the verification of recombinant influenza reassortants is based on sequencing the relevant parts of the viral genome, our approach identified the reassortant gene segment composition directly through the HRM technique. A prerequisite for this method is a set of primer pairs that cover all of the SNP positions that distinguish the viral segments. Therefore, sufficient sequence information must be available before suitable primers can be designed.

In our opinion, the use of universal primers, i.e., primers that are applicable to all influenza genomes, is unfavourable because the efforts and costs associated with the design of specific primers for each tested sequence are low. In addition primer design of universal primers that generated an amplicon suitable for HRM analysis for all divergent influenza viruses would be hard to achieve.

The virus strains tested in this study were selected because they are closely related and thus difficult to differentiate. However, the applied system discriminated the sequences correctly without any problems, and the distinction of more distantly related sequences (comprising more SNP positions) should therefore be even easier using the proposed HRM analysis. Further potential applications of this technology include the screening of genetically engineered influenza viruses to determine whether reassortment or mutation has occurred and the identification of reassortant viruses from field samples.

Conclusion

In conclusion, HRM is a valuable tool for the rapid and easy identification of reassortant influenza viruses in various settings because the total costs for genotyping by HRM are low, i.e., only a simple PCR system and a generic dye are needed.

Methods

Viruses, primers, and isolation of viral RNA

Two highly pathogenic avian influenza viruses (HPAIV) of subtype H5N1: A/swan/Germany/R65/2006 [Gisaid: EPI103081, EPI103089, EPI103087, EPI103075, EPI103085, EPI103077, EPI103079, and EPI103083] and A/Beijing duck/Germany/R1959/2007 [EPI171617, EPI171618, EPI171619, EPI171620, EPI171621, EPI171622, EPI171623, and EPI171624] were genetically engineered (13, Eck unpublished). The reassortant viruses, which were composed of seven segments of one H5N1 strain and one segment of the sister strain, were engineered; these reassortants are called “7 + 1 reassortants”. Figure 2 summarises the unique segment composition of each of the 18 strains generated in this study. Stocks of the original wild-type viruses (R65/06 and R1959/07) were prepared using embryonated chicken eggs. The recombinant virus was rescued as described previously [15] and propagated using Madin-Darby canine kidney cells (MDCK, collection of cell lines in veterinary medicine, FLI Insel Riems, RIE1061). The viral RNA was extracted from the cell culture or allantoic fluid using the QIAamp viral RNA kit (Qiagen) according to the manufacturer’s instructions.
Figure 2

Genomic segment composition of the analysed influenza a strains.

Primer design

The sequence alignment of the original virus strains was used to identify the SNP positions, and specific primers were designed to cover these SNP sequences in each of the eight segments. Therefore, eight primer pairs were designed to obtain an amplicon length ranging from 78 bp to 128 bp. The SNPs consisted of at least two and at the most four nucleotides (Table 1).

Quantitative RT-PCR

A one-step reverse transcription quantitative polymerase chain reaction (RT-qPCR) protocol was performed using the real-time ready RNA-virus-master kit (Roche Applied Science, Mannheim, Germany). The RT-qPCR assay was optimised using a total volume of 10 μl. Briefly, for each single PCR reaction, 5.05 μl of RNase-free water, 2.0 μl of 5× reaction buffer, 0.2 μl of 50× enzyme-blend, 0.5 μl of the primer mix (20 pmol/μl of both primers), and 0.25 μl of LightCycler ResoLight dye (Roche) were pooled to generate a master mix. Then, 2 μl of the RNA template was added to each reaction. The RT-qPCR reactions were performed on both an LightCycler 480 II instrument (Roche) and an Eco Real-Time PCR System (Illumina, San Diego, USA) using a single temperature profile: 8 min at 58°C (reverse transcription), 30 sec at 95°C (inactivation reverse transcriptase/activation Taq polymerase), and 45 cycles of 1 sec at 95°C (denaturation), 20 sec at 55°C (annealing), and 1 sec at 72°C (elongation). The quantification was analysed within each annealing step.

High-resolution melting analysis

The HRM curves were obtained by incubating the PCR products at 95°C for 1 min and then subjecting them to a renaturation step of 70°C for 2 min. In the following melting step, in which the temperature was increased from 70°C to 90°C, 23 fluorescence signal acquisitions per degree centigrade were detected with the Light cycler system (ramp rate of 0.02°C/s), whereas the Eco Cycler system detected 10 signals per degree centigrade (ramp rate of 0.08°C/s). The analyses of the HRM data were performed using the Light Cycler Software (Version 1.5) and the Eco™ Software (v3.0.16.0), respectively (fluorescence signal normalisation is implemented in the software).

The individual RNA segments of the 18 virus strains (reassortants and wild type) were tested on both the Light Cycler system and the Eco Cycler system. The Cq-values determined ranged from 14.2 to 29.1, and Figure 1 shows the average value of eight replicates. The RNA (non-DNA) amplification results were verified by analysing one dataset after it was subjected to DNAse treatment (data available upon request).

Additional file 1: Table S1 presents the results of all of the analysed viral reassortants as row data, and Additional file 2: Figure S1 summarises the derivative plots for each influenza virus segment.

Authors’ information

Donata Kalthoff is a veterinarian at the Institute of Diagnostic Virology at Friedrich-Loeffler-Institut in Greifswald-Insel Riems. Her research interests are focused on pathogenesis and vaccine development.

Abbreviations

Cq: 

Quantification cycle

HPAIV: 

Highly pathogenic avian influenza virus

HRM: 

High-resolution melting

IAV: 

Influenza a virus

PCR: 

Polymerase chain reaction

RT: 

Reverse transcription

SNP: 

Single nucleotide polymorphisms

Tm: 

Melting temperature.

Declarations

Acknowledgements

We are indebted to Patrick Zitzow for the excellent technical assistance. We are also very grateful to Jürgen Stech und Melanie Eck for providing the reverse genetics plasmids. We are thankful to amplifa Labortechnik GmbH (Wasserburg, Germany) and Roche Diagnostics GmbH (Penzberg, Germany) for providing the cycler systems. This project was funded by the European Union FP7 project European Management Platform for Emerging and Re-emerging Infectious Disease Entities (EMPERIE; no. 223498).

Authors’ Affiliations

(1)
Institute of Diagnostic Virology, Friedrich-Loeffler-Institut

References

  1. Neumann G, Watanabe T, Ito H, Watanabe S, Goto H, Gao P, Hughes M, Perez DR, Donis R, Hoffmann E, Hobom G, Kawaoka Y: Generation of influenza A viruses entirely from cloned cDNAs. Proc Natl Acad Sci USA 1999, 96: 9345-50. 10.1073/pnas.96.16.9345PubMedPubMed CentralView ArticleGoogle Scholar
  2. Fodor E, Devenish L, Engelhardt OG, Palese P, Brownlee GG, García-Sastre A: Rescue of influenza A virus from recombinant DNA. J Virol 1999, 73: 9679-82.PubMedPubMed CentralGoogle Scholar
  3. Reed GH, Kent JO, Wittwer CT: High-resolution DNA melting analysis for simple and efficient molecular diagnostics. Pharmacogenomics 2007, 8: 597-608. 10.2217/14622416.8.6.597PubMedView ArticleGoogle Scholar
  4. Costa JM, Cabaret O, Moukoury S, Bretagne S: Genotyping of the protozoan pathogen toxoplaasma gondii using high-resolution melting analysis of the repeated B1 gene. J Microbiol Methods 2011, 86: 357-63. 10.1016/j.mimet.2011.06.017PubMedView ArticleGoogle Scholar
  5. Fortini D, Ciammaruconi A, De Santis R, Fasanella A, Battisti A, D’Amelio R, Lista F, Cassone A, Carattoli A: Optimization of high-resolution melting analysis for low-cost and rapid screening of allelic variants of bacillus anthracis by multiple-locus variable-number tandem repeat analysis. Clin Chem 2007, 53: 1377-80. 10.1373/clinchem.2007.085993PubMedView ArticleGoogle Scholar
  6. Giglio S, Monis PT, Saint CP: Legionella confirmation using real-time PCR and SYTO9 is an alternative to current methodology. Appl Environ Microbiol 2005, 71: 8944-8. 10.1128/AEM.71.12.8944-8948.2005PubMedPubMed CentralView ArticleGoogle Scholar
  7. Patel KP, Barkoh BA, Chen Z, Ma D, Reddy N, Medeiros LJ, Luthra R: Diagnostic testing for IDH1 and IDH2 variants in acute myeloid leukemia an algorithmic approach using high-resolution melting curve analysis. J Mol Diagn 2011, 13: 678-86. 10.1016/j.jmoldx.2011.06.004PubMedPubMed CentralView ArticleGoogle Scholar
  8. Wittwer CT, Reed GH, Gundry CN, Vandersteen JG, Pryor RJ: High-resolution genotyping by amplicon melting analysis using LCGreen. Clin Chem 2003, 49: 853-60. 10.1373/49.6.853PubMedView ArticleGoogle Scholar
  9. Lin JH, Tseng CP, Chen YJ, Lin CY, Chang SS, Wu HS, Cheng JC: Rapid differentiation of influenza A virus subtypes and genetic screening for virus variants by high-resolution melting analysis. J Clin Microbiol 2008, 46: 1090-7. 10.1128/JCM.02015-07PubMedPubMed CentralView ArticleGoogle Scholar
  10. Varillas D, Bermejo-Martin JF, Almansa R, Rojo S, Nogueira B, Eiros JM, Rico L, Iglesias V, Lejarazu RO: A new method for detection of pandemic influenza virus using high resolution melting analysis of the neuraminidase gene. J Virol Methods 2010, 171: 284-6.PubMedView ArticleGoogle Scholar
  11. Tong SY, Dakh F, Hurt AC, Deng YM, Freeman K, Fagan PK, Barr IG, Giffard PM: Rapid detection of the H275Y oseltamivir resistance mutation in influenza A/H1N1 2009 by single base pair RT-PCR and high-resolution melting. PLoS One 2011, 6: e21446. 10.1371/journal.pone.0021446PubMedPubMed CentralView ArticleGoogle Scholar
  12. Chen N, Pinsky BA, Lee BP, Lin M, Schrijver I: Ultrasensitive detection of drug-resistant pandemic 2009 (H1N1) influenza A virus by rare-variant-sensitive high-resolution melting-curve analysis. J Clin Microbiol 2011, 49: 2602-9. 10.1128/JCM.00277-11PubMedPubMed CentralView ArticleGoogle Scholar
  13. Lee HK, Lee CK, Loh TP, Tang JW, Tambyah PA, Koay ES: High-resolution melting approach to efficient identification and quantification of H275Y mutant influenza H1N1/2009 virus in mixed-virus-population samples. J Clin Microbiol 2011, 49: 3555-9. 10.1128/JCM.01087-11PubMedPubMed CentralView ArticleGoogle Scholar
  14. Stech J, Stech O, Herwig A, Altmeppen H, Hundt J, Gohrbandt S, Kreibich A, Weber S, Klenk HD, Mettenleiter TC: Rapid and reliable universal cloning of influenza A virus genes by target-primed plasmid amplification. Nucleic Acids Res 2008, 36: e139. 10.1093/nar/gkn646PubMedPubMed CentralView ArticleGoogle Scholar
  15. Gabriel G, Dauber B, Wolff T, Planz O, Klenk HD, Stech J: The viral polymerase mediates adaptation of an avian influenza virus to a mammalian host. Proc Natl Acad Sci USA 2005, 102: 18590-18595. 10.1073/pnas.0507415102PubMedPubMed CentralView ArticleGoogle Scholar

Copyright

© Kalthoff et al.; licensee BioMed Central Ltd. 2013

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.