Characterization of gene expression on genomic segment 7 of infectious salmon anaemia virus
https://doi.org/10.1186/1743-422X-4-34
© Kibenge et al; licensee BioMed Central Ltd. 2007
Received: 17 January 2007
Accepted: 29 March 2007
Published: 29 March 2007
Abstract
Background
Infectious salmon anaemia (ISA) virus (ISAV), an important pathogen of fish that causes disease accompanied by high mortality in marine-farmed Atlantic salmon, is the only species in the genus Isavirus, one of the five genera of the Orthomyxoviridae family. The Isavirus genome consists of eight single-stranded RNA species, and the virions have two surface glycoproteins; haemagglutinin-esterase (HE) protein encoded on segment 6 and fusion (F) protein encoded on segment 5. Based on the initial demonstration of two 5'-coterminal mRNA transcripts by RT-PCR, ISAV genomic segment 7 was suggested to share a similar coding strategy with segment 7 of influenza A virus, encoding two proteins. However, there appears to be confusion as to the protein sizes predicted from the two open reading frames (ORFs) of ISAV segment 7 which has in turn led to confusion of the predicted protein functions. The primary goal of the present work was to clone and express these two ORFs in order to assess whether the predicted protein sizes match those of the expressed proteins so as to clarify the coding assignments, and thereby identify any additional structural proteins of ISAV.
Results
In the present study we show that ISAV segment 7 encodes 3 proteins with estimated molecular masses of 32, 18, and 9.5 kDa. The 18-kDa and 9.5-kDa products are based on removal of an intron each from the primary transcript (7-ORF1) so that the translation continues in the +2 and +3 reading frames, respectively. The segment 7-ORF1/3 product is variably truncated in the sequence of ISAV isolates of the European genotype. All three proteins are recognized by rabbit antiserum against the 32-kDa product of the primary transcript, as they all share the N-terminal 22 amino acids. This antiserum detected a single 35-kDa protein in Western blots of purified virus, and immunoprecipitated a 32-kDa protein in ISAV-infected TO cells. Immunofluorescence staining of infected cells with the same antiserum revealed the protein(s) to be localized in the cytoplasm. Vaccination of farmed Atlantic salmon with the 32-kDa protein resulted in a higher survival rate than what was attainable with the HE protein, albeit a moderate protection against the low ISAV challenge.
Conclusion
Collectively, our observations suggest that the product of ISAV segment 7 primary transcript (7-ORF1) is a structural protein. The 18-kDa (7-ORF1/2) protein is identified as the putative ISAV nuclear export protein based on the presence of nuclear export signals. The function of the 9.5-kDa (7-ORF1/3) protein is not presently known.
Keywords
Background
Infectious salmon anaemia (ISA) virus (ISAV) is an important pathogen of fish that causes disease accompanied by high mortality in marine-farmed Atlantic salmon. The disease has caused severe economic losses to the salmon-farming industry in several countries in the northern hemisphere including Norway, Faroes Islands (Denmark), USA and Canada, and confirmed positive diagnostic results for ISA are reportable to the "Office International des Epizooties", OIE [1]. It is generally accepted that vaccination is the best option for control of the disease in marine-farmed fish, but the presently available whole virus inactivated vaccine that is used in Maine, USA, and Canada does not fully protect against the virus [2].
ISAV is the only species in the genus Isavirus, which is one of five genera of the Orthomyxoviridae family [3]. Viruses in the genus Isavirus contain a segmented genome of eight single-stranded RNA species of negative sense ranging in length from 1.0 to 2.4 kb with a total molecular size of approximately 14.3–14.5 kb [4, 5]. Different researchers have collectively sequenced all eight RNA genomic segments of ISAV. Assignments of viral proteins to these segments have been predominantly based on amino acid composition, computer-assisted motif identification, and counterparts of influenza viruses. It is becoming increasingly clear that the gene-coding assignments of the ISAV genome differ from those of other orthomyxoviruses [1, 6]. Thus the enveloped particles have a diameter of 90–140 nm with two surface glycoproteins; haemagglutinin-esterase (HE) protein, a receptor binding haemagglutinin with receptor destroying enzyme activity demonstrated to be an acetylesterase [7, 8] encoded on segment 6, and fusion protein (F) [9] encoded on segment 5. Sequence analysis of several ISAV isolates on the eight segments consistently reveals two genotypes, one European and one North American.
The ISAV segment 7 was originally assumed to encode two putative matrix proteins [10], analogous to M1 and M2 proteins of segment 7 of influenza A virus [11]. In that proposed gene expression model for ISAV segment 7, the putative M2 protein shared the first 22 amino terminal residues including the initiating methionine of the M1, but with the removal of the 526 nucleotide intron and resultant frameshift, the translation continued in the +2 reading frame terminating downstream of the M1 exon [10]. However, the M1 and M2 proteins predicted to have molecular weights of 34.1 kDa and 17.7 kDa, respectively, were not verified, although M2 was suggested as the fusion protein because of its similarity (38% identity) to the fusion glycoprotein F of rinderpest virus [10]. Biering et al. [12] expressed segment 7 open reading frame (ORF) 1 in Escherichia coli and prepared rabbit antibodies to the expressed protein. Because the segment 7 ORF1 protein did not react with whole ISAV antiserum, it was considered to be nonstructural or a minor structural protein [12]. In subsequent studies, these authors reported the 7-ORF1 product to be an interferon-signalling antagonist, a function similar to that of the non-structural (NS1) protein encoded by segment 8 of influenza A virus [13]. It is apparent that the structural protein profile of ISAV has not been conclusively determined. This information is essential in order to understand the viral proteins that are important in inducing protective immune responses in fish and/or viral proteins that could be targeted in viral diagnosis.
The primary goal of the present work was to clone and express the two ORFs in ISAV segment 7 in order to assess whether the protein sizes predicted from the ORFs match those of the expressed proteins so as to clarify the coding assignments, and thereby identify any additional structural proteins of ISAV.
Results and Discussion
In-vitro expression of ISAV proteins
The oligonucleotide primers used in amplification of viral cDNA and construction of transcription vectors for ISAV genes
Designated name and (size) of primer | Sequence | Nucleotide position, and GenBank Accession number | |
---|---|---|---|
ISAV SEG1p1 FOR (26 mer) | GTCGAC CAGCTAAGAATGGACTTTAT | 1–20, | AY168787 |
ISAV SEG1p4 REV (28 mer) | GGTACC TTAAACACCATATTCATCCATC | 1634–1685, | AF404347 |
ISAV SEG2p5 FOR (28 mer) | GTCGAC ATAACCATGGAAACTCTAGTAG | 29–50, | AF404346 |
ISAV SEG2p8 REV (28 mer) | GGTACC TCAAACATGCTTTTTCTTCTTA | 2140–2161, | AF404346 |
ISAV SEG3 FOR (18 mer) | ATGGCCGATAAAGGTATG | 49–66, | AF404345 |
ISAV SEG3 REV (18 mer) | CTAAATGTCAATGTCTTC | 1882–1899, | AF404345 |
ISAV SEG4 FOR (20 mer) | ATGGATAACCTCCGTGAATG | 5–24, | AF404344 |
ISAV SEG4 REV (18 mer) | TCATTGGGTACTGACTGC | 1724–1741, | AF404344 |
ISAV SEG5 FOR (21 mer) | ATGGCTTTTCTAACAATTTTA | 9–29, | AF404343 |
ISAV SEG5 REV (21 mer) | CTACCCTTTAGTAATGTACAG | 1368–1388, | AF404343 |
ISAV SEG6 FOR (25 mer) | ATGGCACGATTCATAATTTTATTCC | 20–44, | AJ276859 |
ISAV SEG6 REV (24 mer) | GTTGTCTTTCTTTCATAATCAAGC | 1181–1204, | AJ276859 |
ISAV SEG7 (ORF1) FOR (23 mer) | ATGGATTTCACCAAAGTGTATGG | 22–44, | AF328627 |
ISAV SEG7 (ORF1) REV (23 mer) | TCACATTCTGAAGTGAAGTCCAG | 902–924, | AF328627 |
ISAV SEG7 (ORF2) FOR (82 mer) | ATGGATTTCACCAAAGTGTATGGT | 22–84/611–629, | AF328627 |
GTGCTGGTTGACCAACTAAAACTT | |||
CACGGAAAAGACAAGGTGGCTTCT TTCCTGTCGG | |||
ISAV SEG7 (ORF2)_REV (24 mer) | CATCTTTAGTTCTCATTACAAATG | 1009–1032, | AF328627 |
ISAV SEG8 (ORF1) FOR (18 mer) | ATGAACGAATCACAATGG | 12–29, | AF312317 |
ISAV SEG8 (ORF1) REV (18 mer) | TTACTTCAGGTACCCCAG | 585–602, | AF312317 |
ISAV SEG8 (ORF2) FOR (21 mer) | ATGGATACAAAAACATCTACC | 26–46, | AF312317 |
ISAV SEG8 (ORF2) REV (21 mer) | ATTTATTGTATAGAGTCCTCC | 733–753, | AF312317 |
Autoradiograph of SDS-PAGE of expressed proteins labeled with [ 35 S]methionine in a coupled in vitro TNT System with the different constructs in pCR ® II-TOPO ® plasmid and in TO cells infected with ISAV. The prestained protein standards (Invitrogen Life Sciences) are drawn in on the left while corresponding molecular masses of the ISAV proteins seen above the background of cellular proteins are indicated on the right. (A) Lanes 1 to 8 contain radiolabeled proteins synthesized in uninfected TO cells, ISAV-infected TO cells at 24, 48 and 96 hr post-infection, and in TNT System with constructs of ORFs in ISAV segments 3–6, respectively. Lanes 9 and 10 contain radiolabeled proteins synthesized in TNT System in presence of canine microsomes with constructs of ORFs in ISAV segments 5 and 6, respectively. A band correlating with the product of segment 4 was visible in ISAV-infected cells at 96 hrs (lane 4), and is therefore indicated on the right. (B) Lanes 1 to 8 contain radiolabeled proteins synthesized in uninfected TO cells, ISAV-infected TO cells at 24, 48 and 96 hr post-infection, and in TNT System with constructs of ISAV segment 7 ORFs 1 and 2 and segment 8 ORFs 1 and 2, respectively. Lanes 9 to 12 contain radiolabeled proteins synthesized in TNT System in presence of canine microsomes with constructs of ISAV segment 7 ORFs 1 and 2 and segment 8 ORFs 1 and 2, respectively.
Autoradiograph of SDS-PAGE of expressed proteins labeled with [ 35 S]methionine in a coupled in vitro TNT System with the different constructs in pCR ® II-TOPO ® plasmid and in TO cells infected with ISAV as in Fig. 1, immunoprecipitated with rabbit antiserum to purified ISAV. The prestained protein standards (Invitrogen Life Sciences) are drawn in on the left while corresponding molecular masses of immunoprecipitated ISAV proteins are indicated on the right. (A) Lanes 1 to 8 contain radiolabeled proteins synthesized in uninfected TO cells, ISAV-infected TO cells at 24, 48 and 96 hr post-infection, and in TNT System with constructs of ORFs in ISAV segments 3–6, respectively. (B) Lanes 1 to 8 contain radiolabeled proteins synthesized in uninfected TO cells, ISAV-infected TO cells at 24, 48 and 96 hr post-infection, and in TNT System with constructs of ISAV segment 7 ORFs 1 and 2 and segment 8 ORFs 1 and 2, respectively.
Further characterization of the protein encoded by segment 7 ORF 1
To determine if the segment 7 ORF 1 protein is one of the integral membrane proteins of ISAV, its amino acid sequence was examined for hydrophobic membrane attachment sequences or transmembrane motifs using the TMHMM prediction algorithm, version 2.0 [18], which showed it not to be a transmembrane protein. A similar observation was previously made by Ritchie et al. [10]. The sequence analysis of the segment 7 ORF 1 protein, however, revealed that it has four predicted N-myristoylation sites, at positions 69GSCVSF74, 203GLKGSW208, 206GSWGGW211, and 271GCTGSA276. Such a signal peptide(s) would allow the predicted protein to be associated with the membrane even in the absence of a transmembrane motif, making it a putative monotopic integral membrane protein [19].
Analysis of purified ISAV and GST proteins in Western blots. The prestained protein standards (Invitrogen Life Sciences) are drawn in on the left while corresponding molecular masses of proteins are indicated on the right. (A) Coomassie blue-stained gel of the proteins. Lane M contains the prestained protein standards. Lanes 1 to 3 contain purified ISAV, GST-7ORF1 fusion protein inclusion bodies, and GST protein, respectively. (B) Western blots reacted with rabbit antiserum to whole ISAV. Lanes 1 and 2 contain purified ISAV and GST protein, respectively. (C) Western blots reacted with rabbit antiserum to GST-7ORF1 fusion protein. Lanes 1 and 2 contain purified ISAV and GST protein, respectively.
Immunofluorescence of ASK-2 cell cultures infected with ISAV and stained with rabbit antiserum to GST-7ORF1 fusion protein. Upper panel are cells 1 day post-inoculation with ISAV. Lower panel are cells 6 days post-inoculation with ISAV.
Immunofluorescence of ASK-2 cell cultures infected with ISAV and stained with rabbit antiserum to GST-7ORF1 fusion protein.
Days post-inoculation with ISAV RPC/NB 980-049-1 | ASK-2 cell line | TO cell line | CHSE-214 cell line |
---|---|---|---|
1 | C-, IF± | C-, IF- | C-, IF- |
3 | C+++, IF+++ | C+, IF+ | C-, IF- |
6 | C++++++, IF++++++ | C++++, IF+++++ | C-, IF± |
Vaccination of Atlantic salmon with the GST-7 ORF1 fusion protein protects against ISAV-induced mortality
Percent cumulative mortality of Atlantic salmon vaccinated with different vaccine preparations and then challenged with ISAV isolate NBISA01. (A) Vaccinated fish challenged with low challenge dose (103.5 TCID50/0.2 ml/fish). (B) Vaccinated fish challenged with high challenge dose (106.0 TCID50/0.2 ml/fish).
Relative percent survival (RPS) of ISAV vaccines in Atlantic salmon using two different challenge doses
ISAV vaccine, and number of fish used | Total mortality (%) | RPSa |
---|---|---|
High challenge dose of 106.1 TCID50/fish | ||
GST-Seg 6, 46 fish | 12 (26.1%) | 67.5% |
GST-Seg 7 ORF1, 46 fish | 14 (30.4%) | 62.2% |
GST in BL21 E. coli, 45 fish | 14 (31.1%) | 61.3% |
Unvaccinated fish, 46 fish | 37 (80.4%) | 0.0% |
Low challenge dose of 103.5 TCID50/fish | ||
GST-Seg 6, 46 fish | 21 (45.6%) | 41.8% |
GST-Seg 7 ORF1, 43 fish | 11 (25.6%) | 67.3% |
GST in BL21 E. coli, 43 fish | 8 (18.6%) | 76.2% |
Unvaccinated fish, 46 fish | 36 (78.3%) | 0.0% |
Characterization of ISAV segment 7 ORF1/2 protein
In a separate study in our laboratory, not described in this paper, the segment 7 ORF1/2 (18-kDa) product showed specific strong binding with caspase-8; also weaker binding reactions were noted with segments 1 ORF and 7 ORF1 products [22]. Analysis of the predicted amino acid sequence of the segment 7 ORF1/2 product in this study showed that it contains 3 leucine-rich segments (44LDLLRDQVDSL54, 67LDPGLYPWL75, 113LEFSLGL119). Similar sequences have been suggested to be essential for proper functioning of the influenza nuclear export protein (NEP) nuclear export signal [23], and leucine-rich nuclear export signals (LxxLxxLxLxL) have been described for other viral proteins such as HIV Rev [24]. We therefore speculate that the segment 7 ORF1/2 (18-kDa) protein is the putative ISAV NEP.
Identification of a third functional ORF in ISAV segment 7
Autoradiograph of SDS-PAGE of expressed proteins labeled with [ 35 S]methionine in TO cells infected with ISAV, immunoprecipitated with rabbit antiserum to GST-7ORF1 fusion protein. The prestained protein standards (Invitrogen Life Sciences) are drawn in on the left while corresponding molecular masses of immunoprecipitated ISAV proteins are indicated on the right. Lanes 1 to 6 contain radiolabeled proteins synthesized in uninfected TO cells, ISAV-infected TO cells at 1–5 days post-infection, respectively.
New gene expression model for segment 7 of ISAV of North American genotype. There are 3 ORFs consisting of the primary transcript (7-ORF1) 300 amino acids long, and 7-ORF1/2 and 7ORF1/3 each with an intron removed from 7-ORF1 and consisting of 159 and 81 amino acids, respectively.
Open reading frames of RNA segment 7 of selected ISAV isolates
ISAV isolate | ISAV genotype1 | GenBank Accession Number | Seg. 7-ORF1 | Seg. 7-ORF1/2 | Seg. 7-ORF1/3 |
---|---|---|---|---|---|
RPC/NB 98-049-1 | North American, HPR21 | EF523761 | 1–9032 | 1–66/593–1006 | 1–66/324–503 |
RPC/NB 02-1179-4 | North American, HPR21 | EF523762 | 1–903 | 1–66/593–1006 | 1–66/324–503 |
RPC/NB 98-0280-2 | North American, HPR20 | AF401083 | 1–903 | 1–66/593–1006 | 1–66/324–503 |
RPC/NB 02-0775-14 | North American, HPR21 | DQ673253 | 1–903 | 1–66/593–1006 | 1–66/324–503 |
7833-1 | North American, HPR21 | AF401082 | 1–903 | 1–66/593–1006 | 1–66/324–503 |
RPC/NB 01-0593-1 | North American, HPR21 | EF523764 | 1–903 | 1–66/593–1006 | 1–66/324–503 |
RPC/NB 01-0973-3 | North American, HPR21 | EF523765 | 1–903 | 1–66/593–1006 | 1–66/324–503 |
RPC/NB 04-085-1 | European, new HPR | EF432566 | 1–903 | 1–66/593–1006 | 1–66/324–446 |
485/9/97 | European, HPR14 | DQ673254 | 1–903 | 1–66/593–1006 | 1–66/324–362 |
390/98 | European, HPR7 | EF523763 | 1–903 | 1–66/593–1006 | 1–66/324–362 |
Conclusion
Several conclusions can be summarized: (i) Although a detailed analysis of all the ISAV proteins is not the primary subject of this communication, it is apparent that the ISAV genome, like the influenza A virus genome [26], encodes at least nine structural proteins but the gene order and putative functional identities of the ISAV proteins are significantly different from those of influenza viruses. (ii) We have provided a revised gene expression model of ISAV segment 7 together with evidence suggesting that segment 7 encodes 3 proteins. (iii) We have identified and characterized the protein encoded by segment 7 ORF1 as a 35-kDa minor structural protein of ISAV. (iv) Additionally, we show that vaccination of farmed Atlantic salmon with the segment 7 ORF1 protein resulted in a moderate protection against a severe ISAV challenge. (v) Based on the presence of nuclear export signals in the protein encoded by segment 7 ORF1/2, we have identified it as the putative ISAV nuclear export protein. (vi) The segment 7 ORF1/3 is a new protein of unknown function which is 81 amino acids in ISAV of North American genotype but terminates after 62 or 32 aa in ISAV isolates of the European genotype. We are presently studying these proteins to determine their functional roles in ISAV.
Methods
Cells, viruses, and virus culture
Origin and genotype of different ISAV isolates
Isolate and geographic origin | Laboratory source1 and Year of isolation | ISAV genotype2 |
---|---|---|
NBISA01, NB, Canada | Aqua Health, 1998 | North American, HPR21 |
RPC/NB 98-049-1, NB, Canada | RPC, 1998 | North American, HPR21 |
RPC/NB 98-0280-2, NB, Canada | RPC, 1998 | North American, HPR20 |
7833-1, Chile | Aquatic Health, 1999 | North American, HPR21 |
RPC/NB 01-0593-1, NB, Canada | RPC, 2001 | North American, HPR21 |
RPC/NB 02-0973-3, NB, Canada | RPC, 20021 | North American, HPR21 |
RPC/NB 02-0775-14, NB, Canada | RPC, 2002 | North American, HPR21 |
RPC/NB 02-1179-4, NB, Canada | RPC, 2002 | North American, HPR21 |
485/9/97, Norway | B. Dannevig, 1997 | European, HPR14 |
810/9/99, Norway | B. Dannevig, 1999 | European, HPR15 |
U5575-1, NS, Canada | AVC, 2000 | European, HPR3 |
RPC/NB 04-085-1, NB, Canada | RPC, 2004 | European, new HPR |
Construction of in-vitro transcription plasmids containing ISAV cDNA
The oligonucleotide primers (Table 1) spanning the ORFs in the eight RNA segments were designed from publicly available ISAV genome sequences in the GenBank database, and were purchased from a commercial source (Invitrogen Life Technologies). For segments 1, 2, and 3, overlapping RT-PCR products were initially generated and then used to obtain the complete ORFs. For the purpose of evaluating individual ORFs, we separated the otherwise partial overlapping ORFs of segment 7 based on the gene expression model suggested by Ritchie et al. [10], of partial splicing of ORF1 mRNA and a frameshift such that ORFs 1 and 2 products share the first 22 amino acid residues. The RT-PCR amplification of viral cDNA and cloning and nucleotide sequencing procedures used in this study were previously described [30]. Thus the PCR products were cloned into the pCR®II vector having dual promoters T7 and SP6 in opposite orientation (Invitrogen Life Technologies) for in vitro coupled transcription and translation (TNT-Promega) reactions. Plasmids were sequenced to check for correct orientation and to verify each viral cDNA sequence.
Cell-free transcription-translation
The pCR®II-TOPO® recombinant plasmids were used as circular DNA templates. Approximately 1 μg each of plasmid DNA was transcribed directly in a translation mix containing 20 μCi of [35S]methionine (Amersham Pharmacia Biotech) in 50 μl-reaction volumes using the in vitro transcription-translation TNT™ T7/SP6 Coupled Reticulocyte Lysate System (TNT-RLS, Promega) as per the manufacturer's instructions. A Luciferase DNA (supplied by Promega) was used as positive control. Following incubation of the reactions for 90 min at 30°C, 5 μl of each reaction were mixed with 20 μl of 2× Laemmli sample treatment buffer (0.125 M Tris-HCl pH 6.8, 4% SDS, 20% glycerol, 0.002% bromophenol blue, 4% 2-mercaptoethanol) [31] and heated at 60°C for 20 min to denature the proteins. Ten microliters of the denatured sample were resolved on discontinuous SDS-12-5% PAGE [32] and radiolabeled proteins in dried gels were visualized by autoradiography for 48 h at room temperature. The molecular weights of the proteins were calculated from the gels using standard procedures [33]. To examine for glycosylation, a general protocol recommended by the manufacturer for translation in the TNT-RLS with canine microsomal membranes (Roche Molecular Biochemicals) was followed and samples were analyzed by 12.5% SDS-PAGE and autoradiography.
Construction of pGEX expression plasmid and preparation of GST fusion protein
The pCR®II-TOPO® recombinant plasmids, pCR TOPO-Seg7ORF1 and pCR TOPO-Seg6ORF were used as the source of the ISAV segment 7 ORF1 and segment 6 ORF, respectively. PCR was performed using the DeepVent DNA polymerase (New England Biolabs) as specified in the manufacturer's protocol. The PCR products were subcloned into the pGEX-5X-2 expression vector (Amersham Biosciences) to produce constructs pGEX5X2-7ORF1 and pGEX5X2-6ORF. These constructs were designed to generate the full-length ISAV segment 7 ORF1 polypeptide and the ISAV HE polypeptide, respectively, each fused with GST at its N-terminus, and this was verified by DNA sequencing.
The plasmid constructs were used to transform competent E. coli strain BL21(DE3)(pLysS) (Novagen) in order to express the GST fusion proteins. Transformants were cultivated on LB (Luria-Bertani) broth agar medium containing 100 μg ml-1 ampicillin. An overnight LB broth culture of the transformant was pelleted by centrifugation, washed with LB medium (10 g/L bactotryptone, 5 g/L yeast extract, and 5 g/L NaCl, adjusted to pH 7.4) containing 200 μg ml-1 ampicillin and diluted 100× in 2-4L of LB medium supplemented with 2 g/L dextrose and 150 μg ml-1 ampicillin and grown at 37°C with agitation (165 rpm). When the optical density reached a value of 0.7 at 600 nm, protein expression was induced at 15°C by addition of IPTG (Amersham Biosciences) to a final concentration of 0.1 mM. Cells were harvested by centrifugation at 6,000 g for 12 min at 4°C and resuspended in 40 ml PBS (150 mM NaCl, 16 mM Na2HPO4, and 4 mM NaH2PO4, pH 7.3). This step was repeated twice to wash the cells. The supernatant was discarded and the wet cell paste was frozen at -20°C overnight. The bacterial cells were thawed, re-suspended in lysis buffer containing 50 mM Tris pH 8.0, 500 mM NaCl, 1 × BugBuster protein extraction reagent (Novagen), 1 mM DTT, 10% glycerol, 300 μg ml-1 lysozyme, 1 mM PMSF, Complete protease inhibitor (Roche Applied Science), and incubated with stirring for 2 h at 4°C. Then, Benzonase nuclease (Novagen) was added as specified by the supplier, incubated with slow stirring at 4°C for 1 h. The cells were centrifuged at 10,000 g for 1 h. The supernatants were collected and filtered using 0.45 μm filters (Gelman Sciences) for affinity chromatography purification. The GST-7ORF1 fusion protein and the GST-HE fusion protein contained in the supernatants were separately purified by affinity chromatography using Glutathione Sepharose (Amersham Biosciences) batch method at 4°C according to the manufacturer's protocol. The final elutes of each fusion protein were pooled, concentrated and desalted using Centricon-Plus 20 (Amicon). The concentration of each fusion protein was estimated roughly by spectrophotometry at 280 nm where 1A = 0.5 mg/ml GST fusion protein, and its purity and integrity were analyzed by resolving it on discontinuous SDS-12.5% PAGE [32] and visualized with Coomassie Blue R-250 (Bio-Rad). The BL 21 strain of E. coli without ISAV gene was lysed with 0.5% NP-40 (Sigma) and then clarified at 700 g to obtain the bacterial lysate without ISAV proteins.
Rabbit antiserum production
Preparation of rabbit polyclonal antiserum to purified ISAV isolate RPC/NB 980 049-1 has been described [15]. Rabbit polyclonal antiserum to GST-7 ORF1 fusion protein was prepared using a similar procedure. Briefly, GST-7 ORF1 fusion protein inclusion bodies were resuspended in Arginine buffer (10 mM Tris-HCl, 150 mM NaCl, 800 mM L-Arginine, pH 8.5). Two hundred and fifty microliters of the suspension were brought to 1.25 ml with PBS and were then aliquoted into 250 μl-volumes. One 250 g rabbit (Charles River Canada) was inoculated subcutaneously five times at 3-week intervals with 250 μl of the GST-7 ORF1 fusion protein, once mixed with an equal volume of Freund's complete adjuvant and four times in Freund's incomplete adjuvant. Pre-inoculation serum and sera collected every 3 weeks until after the last injection were tested for the presence of antibodies against purified ISAV by Western blot analysis.
Fish vaccination assay
Specific pathogen-free Atlantic salmon parr (St. John River stock) were obtained either from the Cardigan Fish Hatchery, Cardigan, P.E.I. or Atlantic Sea Smolt Ltd., Souris, P.E.I., Canada. The average weight of the fish at the start of the trial was 9.1 gm in the freshwater phase. An opportune sample of five fish was screened for ISAV by virus isolation attempts from tissue samples (kidney, heart, spleen, pyloric caeca) on the TO cell line and monitoring for CPE and RT-PCR [30] to establish the ISAV-negative status of the stock before the vaccination. The fish were maintained in the Aquatic Animal Facility of the Atlantic Veterinary College (AVC) in 1 m diameter fibreglass-reinforced plastic tanks using a freshwater flow through system at a temperature of approximately 11°C. The fish were acclimatized in freshwater for 2 weeks at a water flow rate of 3.5 L/min. The experimental procedures used in this study were performed in accordance with the guidelines of the Canadian Council of Animal Care [34].
The fish were divided into groups: the unvaccinated group consisted of 187 fish in one tank while each of the vaccinated groups consisted of 43–46 fish per tank in two tanks. For the vaccination, the fish were removed from the stock holding tank and anaesthetized by immersion in an aerated solution of tricaine methane sulphonate (TMS-222) (100 mg/L). The vaccination consisted of an intraperitoneal injection with a vaccine dose of 50 μg/0.2 ml/fish and the fish was then returned to the respective study tank. The fish were held for 56 days and then each vaccinated group was challenged with ISAV isolate NBISA01 using two different doses for each two tanks; a high dose (106.1 TCID50) and a low dose (103.5 TCID50). For this challenge trial, the fish in the unvaccinated tank were divided into three groups: two groups consisted of 46 fish in each tank to serve as the unvaccinated challenged controls for the high and low challenge doses while the remaining 95 fish were moved to an uninfected control tank which was located in a separate "clean" room away from the tanks with the vaccinated fish. For the experimental infection, the challenge fish were removed from the respective tank and anaesthetized as before. Each fish was then challenged by the intraperitoneal route with 0.2 ml of virus suspension of the high dose or low dose of ISAV and was then returned to the respective study tank. Caution was taken to avoid contact between the tanks for the two different challenge doses. Fish were fed once everyday and the fish tanks were flushed once a day. All tanks were checked twice daily for mortality, the fish were observed for abnormal behaviour, and external lesions until the study was terminated at 42 days post challenge. All dead fish were necropsied and, where necessary, tissues (kidney, heart, spleen, pyloric caeca) were collected for virus detection by reverse transcriptase PCR (RT-PCR) amplification and histopathology.
Pulse labeling infected cells with [35S]methionine
The TO, ASK-2, and CHSE-214 cells in 4-well tissue culture plates or 25 cm2 tissue culture flasks were infected with ISAV at a multiplicity of infection of 10, and labeled with [35S]methionine as described previously [15, 35], with slight modifications. Briefly, at 1, 2, 3, 4, 5, and 6 days post-infection, monolayers were washed twice with cold phosphate buffered saline (PBS), pH 7.2, and were incubated in 1 ml/well methionine-free EMEM supplemented with 5% dialyzed FBS to deplete residual methionine. After 2.5 h, cells were radiolabeled for 20 h with 100–200 μCi of [35S]methionine (specific activity approximately 1000 Ci/mmol at 10 μCi/μl; Amersham Pharmacia Biotech) in 1–2 ml methionine-free EMEM containing 5% dialyzed FBS. To obtain labeled cells, the medium was aspirated and cells were washed twice with PBS and then lysed with 500 μl RIPA buffer (150 mM NaCl, 1% sodium deoxycholate, 1% aprotinin, 1% Triton X-100, 1% sodium dodecyl sulfate, 10 mM Tris-HCl, pH 7.2). The lysate was centrifuged at 12,000 g for 2 min and the supernatant was transferred to a fresh microfuge tube and stored at -20°C until used.
Immunoprecipitation of polypeptides
ISAV proteins synthesized in ISAV-infected cells or by in vitro transcription-translation system were analyzed by immunoprecipitation with rabbit antiserum to purified ISAV isolate RPC/NB-980 049-1 prepared as described previously [15]. The immunoprecipitation was carried out as described by Sambrook et al. [36], with slight modifications. Briefly, the 10 μl of cell lysates or in vitro translation sample brought to 500 μl total volume in NET-gel buffer (150 mM NaCl, 0.1% Nonidet P-40, 1 mM EDTA, pH 8.0, 0.25% gelatin, 0.02% sodium azide, 50 mM Tris-HCl, pH 7.5) were initially precleared with pre-immune rabbit serum and Protein-A Sepharose beads (Sigma) to reduce non-specific background. For the specific immunoprecipitations, each precleared supernatant was reacted with 20 μl of rabbit hyper-immune antiserum at 0°C for 1 h. Each mixture was then reacted with Protein-A Sepharose beads at 4°C for 1 h. The Sepharose beads were washed with 10 mM Tris-HCl, pH 7.5, 0.1% NP-40, mixed with 30 μl of 2× SDS sample loading buffer, and heated at 100°C for 5 min prior to fractionation on discontinuous SDS-12-5% PAGE [32]. Radiolabeled proteins in dried gels were visualized by autoradiography for 48 h at room temperature.
Gel electrophoresis of viral proteins and Western blot analysis
Samples were mixed with an equal volume of 2× SDS sample loading buffer, and heated at 100°C for 5 min prior to fractionation on discontinuous SDS-12-5% PAGE (Laemmli 1971). Proteins were visualized with Coomassie blue R-250 (Bio-Rad). Duplicate gels were used in Western blotting as described previously [17]. Briefly, resolved proteins in unstained gels were transferred from the gel to the nitrocellulose membranes using a Trans-Blot apparatus (Bio-Rad) for 4 hr at 60 V (65 mA/cm2). The membranes were blocked with PBS containing 3% skim milk and then reacted with a 1:50 dilution of rabbit antiserum to GST-7 ORF1 fusion protein or to purified ISAV isolate RPC/NB-980 049-1. The blots were reacted with a 1:30,000 dilution of goat anti-rabbit alkaline phosphatase conjugate (Sigma) and colour was developed with BCIP/NBT substrate (Bio-Rad).
DNA sequencing and analysis of sequence data
Plasmid DNA for sequencing was prepared as described before [37]. Denatured plasmid DNA was sequenced using the ABI BIG DYE terminator version 3.1 cycle sequencing kit (Applied Biosystems, Inc.) and the MJ Research thermal cycler. Sequencing reactions were resolved on two DNA sequencers. The first, a model 377 ABI Prism Automated DNA Sequencer (Applied Biosystems, Inc.) using 36–64 lanes on a 48 cm plate. ABI's 'mobility file' that comes with the dye terminator kit was used to correctly call the bases. The electropherograms were inspected and edited using "Sequencing Analysis 3.3" software provided with the 377 Prism by ABI. The second, a model 3100 ABI Genetic Analyzer (Applied Biosystems, Inc.) with a 50 cm – 16 capillary array using POP-6 polymer. ABI's 'mobility file' that comes with the dye terminator kit was used to correctly call the bases. The electropherograms were inspected and edited using "Sequencing Analysis 5.1.1" software provided with the 3100 ABI Genetic Analyzer. Sequence analysis used the BLAST programs [38], the Sequence Manipulation suite [39], and the FASTA program package for microcomputers [40]. The following programs available through ExPASy Molecular Biology Server [41] were also utilized: ScanProsite, MotifScan, PROSCAN, SignalP. V1.1, and TMHMM server v. 2.0 [18, 42]. The ProtScale program was accessed via the Sanger web site [43].
Declarations
Acknowledgements
This work was supported by NSERC Strategic grants and an NSERC Discovery grant to FSBK.
Authors’ Affiliations
References
- Kibenge FSB, Munir K, Kibenge MJT, Joseph T, Moneke E: Infectious salmon anaemia virus: causative agent, pathogenesis and immunity. Ani Hlth Res Rev 2004, 5: 65-78. 10.1079/AHR200461View ArticleGoogle Scholar
- Kibenge FSB, Kibenge MJT, Joseph T, McDougall J: The development of infectious salmon anemia virus vaccines in Canada. In Miller, Otis; Cipriano, Rocco C., tech. coords. International response to infectious salmon anemia: prevention, control, and eradication: proceedings of a symposium; 3–4 September 2002; New Orleans, LA. Tech. Bull. 1902. Washington, DC. U.S. Department of Agriculture, Animal and Plant Health Inspection Service; U.S. Department of the Interior, U.S. Geological Survey; U.S. Department of Commerce, National Marine Fisheries Service; 2003:39-49.Google Scholar
- Anonymous: International Committee on Taxonomy of Viruses, 00.046.0.05.001. Infectious Salmon Anaemia Virus.2002. [http://www.ncbi.nlm.nih.gov/ICTVdb/Ictv/index.htm]Google Scholar
- Clouthier SC, Rector T, Brown NEC, Anderson ED: Genomic organization of infectious salmon anaemia virus. J Gen Virol 2002, 83: 421-428.PubMedView ArticleGoogle Scholar
- Mjaaland S, Rimstad E, Falk K, Dannevig BH: Genomic characterization of the virus causing infectious salmon anaemia in Atlantic salmon ( Salmo salar L ): an orthomyxo-like virus in a teleost. J Virol 1997, 71: 7681-7686.PubMedPubMed CentralGoogle Scholar
- Aspehaug VT: Characterization of major structural proteins of the infectious salmon anaemia virus (ISAV). PhD thesis. University of Bergen, Biology Department; 2005.Google Scholar
- Falk K, Aspehaug V, Vlasak R, Endresen C: Identification and characterization of viral structural proteins of infectious salmon anaemia virus. J Virol 2004, 78: 3063-3071. 10.1128/JVI.78.6.3063-3071.2004PubMedPubMed CentralView ArticleGoogle Scholar
- Hellebø A, Vilas U, Falk K, Vlasak R: Infectious salmon anaemia virus specifically binds to and hydrolyzes 4-O-acetylated sialic acids. J Virol 2004, 78: 3055-3062. 10.1128/JVI.78.6.3055-3062.2004PubMedPubMed CentralView ArticleGoogle Scholar
- Aspehaug VT, Mikalsen AB, Snow M, Biering E, Villoing S: Characterization of the infectious salmon anaemia virus fusion protein. J Virol 2005, 79: 12544-12553. 10.1128/JVI.79.19.12544-12553.2005PubMedPubMed CentralView ArticleGoogle Scholar
- Ritchie RJ, Bardiot A, Melville K, Griffiths S, Cunningham CO, Snow M: Identification and characterization of segment 7 of the infectious salmon anaemia virus genome. Virus Res 2002, 84: 161-170. 10.1016/S0168-1702(01)00375-6PubMedView ArticleGoogle Scholar
- Lamb RA, Lai CJ, Choppin PW: Sequences of mRNAs derived from genome RNA segment 7 of influenza virus: Colinear and interrupted mRNAs code for overlapping proteins. Proc Natl Acad Sci USA 1981, 78: 4170-4174. 10.1073/pnas.78.7.4170PubMedPubMed CentralView ArticleGoogle Scholar
- Biering E, Falk K, Hoel E, Thevarajan J, Joerink M, Nylund A, Endresen C, Krossøy B: Segment 8 encodes a structural protein of infectious salmon anaemia virus (ISAV); the co-linear transcript from Segment 7 probably encodes a non-structural or minor structural protein. Dis Aquat Organ 2002, 49: 117-122.View ArticleGoogle Scholar
- McBeath AJA, Collet B, Paley R, Duraffour S, Aspehaug V, Biering E, Secombes CJ, Snow M: Identification of an interferon antagonist protein encoded by segment 7 of infectious salmon anaemia virus. Virus Res 2006, 115: 176-184. 10.1016/j.virusres.2005.08.005PubMedView ArticleGoogle Scholar
- Griffiths S, Cook M, Mallory B, Ritchie R: Characterization of ISAV proteins in cell culture. Dis Aquat Organ 2001, 45: 19-24.PubMedView ArticleGoogle Scholar
- Kibenge FSB, Kibenge MJ, McKenna PK, Stothard P, Marshall R, Cusack RR, McGeachy S: Antigenic variation among isolates of infectious salmon anaemia virus correlates with genetic variation of the viral haemagglutinin gene. J Gen Virol 2001, 82: 2869-2879.PubMedView ArticleGoogle Scholar
- Falk K, Namork E, Rimstad E, Mjaaland S, Dannevig BH: Characterization of infectious salmon anaemia virus, an orthomyxo-like virus isolated from Atlantic salmon (Salmo salar L.). J Virol 1997, 71: 9016-9023.PubMedPubMed CentralGoogle Scholar
- Kibenge FSB, Lyaku JR, Rainnie D, Hammell KL: Growth of infectious salmon anaemia virus in CHSE-214 cells and evidence for phenotypic differences between virus strains. J Gen Virol 2000, 81: 143-150.PubMedView ArticleGoogle Scholar
- Sonnhammer ELL, von Heijne G, Krogh A: A hidden Markov model for predicting transmembrane helices in protein sequences. In Proceedings of the 6th International Conference on Intelligent Systems for Molecular Biology. Edited by: Glasgow J, Littlejohn T, Major F, Lathrop R, Sankoff D, Sensen C. AAAI Press. Menlo Park, CA; 1998:175-182.Google Scholar
- Blobel G: Intracellular protein topogenesis. Proc Natl Acad Sci USA 1980, 77: 1496-1500. 10.1073/pnas.77.3.1496PubMedPubMed CentralView ArticleGoogle Scholar
- Kibenge FSB, Kibenge MJT, Groman D, McGeachy S: In-vivo correlates of infectious salmon anaemia virus pathogenesis in fish. J Gen Virol 2006, 87: 2645-2652. 10.1099/vir.0.81719-0PubMedView ArticleGoogle Scholar
- Mikalsen AB, Sindre H, Torgersen J, Rimstad E: Protective effects of a DNA vaccine expressing the infectious salmon anaemia virus hemagglutinin-esterase in Atlantic salmon. Vaccine 2005, 23: 4895-4905. 10.1016/j.vaccine.2005.05.025PubMedView ArticleGoogle Scholar
- Joseph T, Cepica A, Brown T, Ikede BO, Kibenge FSB: Mechanism of cell death during infectious salmon anaemia virus (ISAV) infection is cell-type specific. J Gen Virol 2004, 85: 3027-3036. 10.1099/vir.0.80091-0PubMedView ArticleGoogle Scholar
- Paragas J, Talon J, O'Neill RE, Anderson DK, Garcia-Sastre A, Palese P: Influenza B and C virus NEP (NS2) proteins possess nuclear export activities. J Virol 2001, 75: 7375-7383. 10.1128/JVI.75.16.7375-7383.2001PubMedPubMed CentralView ArticleGoogle Scholar
- Cros JF, Palese P: Trafficking of viral genomic RNA into and out of the nucleus: influenza, Thogoto and Borna disease viruses. Virus Res 2003, 95: 3-12. 10.1016/S0168-1702(03)00159-XPubMedView ArticleGoogle Scholar
- Kibenge FSB, Joseph T, Beecroft R, Qian B, Otto T: Generation of monoclonal antibodies to infectious salmon anaemia virus antigens [abstract]. 20th Annual Meeting of the Aquaculture Association of Canada, Victoria, B.C October 29–November 1, 2003Google Scholar
- Cox NJ, Fuller F, Kaverin N, Klenk HD, Lamb RA, Mahy BWJ, McCauley J, Nakamura K, Palese P, Webster RG: Orthomyxoviridae. In Virus Taxonomy. Seventh Report of the International Committee on Taxonomy of Viruses. Edited by: van Regenmortel MHV, Faquet CM, Bishop DHL, Carstens EB, Estes MK, Lemon SM, Maniloff J, Mayo MA, McGeoch DH, Pringle CR, Wickner RB. Springer-Verlag, Wien/New York; 2000:585-597.Google Scholar
- Wergeland HI, Jakobsen RA: A salmonid cell line (TO) for production of infectious salmon anaemia virus (ISAV). Dis Aquat Organ 2001, 44: 183-190.PubMedView ArticleGoogle Scholar
- Rolland JB, Bouchard DA, Winton JR: Improved diagnosis of infectious salmon anaemia virus by use of a new cell line derived from Atlantic salmon kidney tissue. In Miller, Otis; Cipriano, Rocco C., tech. coords. International response to infectious salmon anemia: prevention, control, and eradication: proceedings of a symposium; 3–4 September 2002; New Orleans, LA. Tech. Bull. 1902. Washington, DC. U.S. Department of Agriculture, Animal and Plant Health Inspection Service; U.S. Department of the Interior, U.S. Geological Survey; U.S. Department of Commerce, National Marine Fisheries Service; 2003:63-68.Google Scholar
- Lannan CN, Winton JR, Fryer JL: Fish cell lines: establishment and characterization of nine cell lines from salmonids. In Vitro 1984, 20: 671-676.PubMedView ArticleGoogle Scholar
- Kibenge FSB, Gárate ON, Johnson G, Arriagada R, Kibenge MJ, Wadowska D: Isolation and identification of infectious salmon anaemia virus (ISAV) from Coho salmon in Chile. Dis Aquat Organ 2001, 45: 9-18.PubMedView ArticleGoogle Scholar
- Dobos P, Rowe D: Peptide map comparison of infectious pancreatic necrosis virus-specific polypeptides. J Virol 1977, 24: 805-820.PubMedPubMed CentralGoogle Scholar
- Laemmli UK: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227: 680-685. 10.1038/227680a0PubMedView ArticleGoogle Scholar
- Hames BD: An introduction to polyacrylamide gel electrophoresis. In Gel electrophoresis of proteins, a practical approach. Edited by: Hames BD, Rickwood D. IRL Press Ltd., Oxford, Washington DC; 1981:1-92.Google Scholar
- Olfert ED, Cross BM, McWilliams A: A guide to the care and use of experimental animals. 2nd edition. Bradda Printing Services, Ottawa. ON, Canada; 1993.Google Scholar
- Kibenge FSB, Qian B, Nagy É, Cleghorn JR, Wadowska D: Formation of virus-like particles when the polyprotein gene (segment A) of infectious bursal disease virus is expressed in insect cells. Can J Vet Res 1999, 63: 49-55.PubMedPubMed CentralGoogle Scholar
- Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A Laboratory Manual. Volume 3. 2nd edition. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY; 1989:18.19-18.59.Google Scholar
- Kibenge FSB, Dybing JK, McKenna KP: Rapid procedure for large-scale isolation of plasmid DNA. BioTechniques 1991, 11: 65-67.PubMedGoogle Scholar
- Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic local alignment search tool. J Mol Biol 1990, 215: 403-410.PubMedView ArticleGoogle Scholar
- Stothard P: The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences. BioTechniques 2000, 28: 1102-1104.PubMedGoogle Scholar
- Pearson WR, Lipman DJ: Improved tools for biological sequence comparison. Proc Natl Acad Sci USA 1988, 85: 2444-2448. 10.1073/pnas.85.8.2444PubMedPubMed CentralView ArticleGoogle Scholar
- ExPASy Molecular Biology Server[http://us.expasy.org/]
- Falquet L, Pagni M, Bucher P, Hulo N, Sigrist CJ, Hofmann K, Bairoch A: The PROSITE database, its status in 2002. Nucl Acids Res 2002, 30: 235-238. 10.1093/nar/30.1.235PubMedPubMed CentralView ArticleGoogle Scholar
- Sanger web site[http://www.sanger.ac.uk/Software/Pfam/search.shtml]
- Amend DF: Potency testing of fish vaccines. Dev Biol Standard 1981, 49: 447-454.Google Scholar
- Nylund A, Devold M, Plarre H, Isdal E, Aarseth M: Emergence and maintenance of infectious salmon anemia virus (ISAV) in Europe: A new hypothesis. Dis Aquat Organ 2003, 56: 11-24.PubMedView ArticleGoogle Scholar
- Plarre H, Devold M, Snow M, Nylund A: Prevalence of infectious salmon anaemia virus (ISAV) in wild salmonids in Western Norway. Dis Aquat Organ 2005, 66: 71-79.PubMedView ArticleGoogle Scholar
Copyright
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.