Open Access

Isolation and characterization of the first phage infecting ecologically important marine bacteria Erythrobacter

Virology Journal201714:104

https://doi.org/10.1186/s12985-017-0773-x

Received: 26 October 2016

Accepted: 1 June 2017

Published: 7 June 2017

Abstract

Background

Erythrobacter comprises a widespread and ecologically significant genus of marine bacteria. However, no phage infecting Erythrobacter spp. has been reported to date. This study describes the isolation and characterization of phage vB_EliS-R6L from Erythrobacter.

Methods

Standard virus enrichment and double-layer agar methods were used to isolate and characterize the phage. Morphology was observed by transmission electron microscopy, and a one-step growth curve assay was performed. The phage genome was sequenced using the Illumina Miseq platform and annotated using standard bioinformatics tools. Phylogenetic analyses were performed based on the deduced amino acid sequences of terminase, endolysin, portal protein, and major capsid protein, and genome recruitment analysis was conducted using Jiulong River Estuary Virome, Pacific Ocean Virome and Global Ocean Survey databases.

Results

A novel phage, vB_EliS-R6L, from coastal waters of Xiamen, China, was isolated and found to infect the marine bacterium Erythrobacter litoralis DSM 8509. Morphological observation and genome analysis revealed that phage vB_EliS-R6L is a siphovirus with a 65.7-kb genome that encodes 108 putative gene products. The phage exhibits growth at a wide range of temperature and pH conditions. Genes encoding five methylase-related proteins were found in the genome, and recognition site predictions suggested its resistance to restriction-modification host systems. Genomic comparisons and phylogenetic analyses indicate that phage vB_EliS-R6L is distinct from other known phages. Metagenomic recruitment analysis revealed that vB_EliS-R6L-like phages are widespread in marine environments, with likely distribution in coastal waters.

Conclusions

Isolation of the first Erythrobacter phage (vB_EliS-R6L) will contribute to our understanding of host-phage interactions, the ecology of marine Erythrobacter and viral metagenome annotation efforts.

Keywords

Erythrobacter Marine Siphovirus Complete genome sequence

Background

As ecologically significant marine bacteria, Erythrobacter species (Alphaproteobacteria) are frequently detected in and isolated from nutrient-rich coastal seawaters [15]. Moreover, these microorganisms are thought to comprise a major fraction of the marine photoheterotrophs known as aerobic anoxygenic phototrophic bacteria (AAPBs), which play a significant role in the cycling of both organic and inorganic carbon in the ocean [2, 68]. To date, 19 Erythrobacter species have been reported, and genomic and metabolic studies have shown that members of this genus are metabolically versatile [5, 911]. The first marine Erythrobacter isolate was E. longus DSM 6997, which was also the first AAPB identified [1]. In 1994, E. litoralis DSM 8509, containing the carotenoids bacteriorubixanthinal and erythroxanthin sulfate, was isolated from a marine cyanobacterial mat [12]. In addition, previous studies have demonstrated the potential use of Erythrobacter species (e.g., E. longus and E. citreus) for bioremediation of alkane contamination [13]. These species show high levels of resistance to tellurite and accumulate metallic tellurium crystals (e.g., E. longus) [14]; enantioselective epoxide hydrolase activity (e.g., E. longus) has also been reported [15].

Bacteriophages (viruses that infect bacteria) have important roles in the abundance, activity, and diversity of bacterial communities [1618], and isolation and genomic characterization of phages greatly improves our understanding of the ecology and evolution of their hosts. For example, cyanophages (viruses that infect cyanobacteria) are active and abundant agents of mortality that directly affect the distribution and species composition of cyanobacteria in the aquatic environment [17, 19]. In addition, investigation of SAR11 viruses helped to show that the highly abundant distribution of these viruses is the result of adaptation to resource competition [20]. It has also been suggested that roseophages (viruses that infect Roseobacter species, another representative genus of Alphaproteobacteria) can quickly alter the growth and abundance of their host population by changing their infection strategy and can shunt bacterial secondary production into the environmental dissolved-carbon pool [e.g., [21, 22].

Isolation of novel phages can assist with both the annotation of unidentified functional genes and in the discovery of diverse and widespread viral assemblages in aquatic and marine environments through virome database query [20, 22, 23]. However, no phage infecting Erythrobacter has been reported to date, hindering an integrated understanding of the life cycle of these microbes in the ocean. In this study, we report the first isolation of a novel phage infecting E. litoralis DSM 8509.

Methods

Bacterial strains and growth conditions

All of the bacterial strains used in this study are listed in Table 1. E. litoralis DSM 8509 and other strains were cultivated at 30 °C in RO medium, an artificial seawater medium containing 1 g/L yeast extract, 1 g/L tryptone, and 1 g/L sodium acetate at pH 7.5 [24].
Table 1

Bacterial strains used in the host-range test and their susceptibility to the phage vB_EliS-R6L

Strains

Best matched species (% Id of 16S rDNA)

Source and location

References

Susceptibility to phage vB_EliS-R6L

Efficiency of plaquing

Erythrobacter litoralis DSM 8509*

 

Cyanobacterial mat, Netherlands

[12]

+

100%

Erythrobacter longus DSM 6997*

 

Seaweed Enteromorpha linza, Japan

[1]

+

94.74 ± 3.78%

Erythrobacter sp. JL 475

 

Surface sea water, South China sea, China

[11]

-

-

JL 2316

Erythrobacter sp. CC-AMZ-30 L (97.12)

Surface sea water, Pacific Ocean

 

-

-

JL 967

Erythrobacter sp. M71_W20 (100.00)

Surface sea water, Taiwan strait, China

 

-

-

JL 1267

Erythrobacter sp. MON004 (100.00)

Surface sea water, South China sea, China

 

-

-

JL 971–1

Erythrobacter nanhaisediminis (99.33)

Surface sea water, Taiwan strait, China

 

-

-

JL 1059

Erythrobacter nanhaisediminis

T30 (99.22)

Upper sea water (150 m), West Pacific Ocean

 

-

-

JL 1033

Erythrobacter nanhaisediminis T30 (99.69)

Upper sea water (50 m), West Pacific Ocean

 

-

-

JL 1302

Erythrobacter nanhaisediminis T30 (97.79)

Surface sea water, South China sea, China

 

-

-

JL 1201

Erythrobacter vulgaris TVG01-C004 (99.80)

Surface sea water, West Pacific Ocean

 

-

-

JL 274–1

Erythrobacter vulgaris 022 2–10 (99.22)

Changjiang Estuary, China

 

-

-

JL 1500

Erythrobacter pelagi UST081027–248 (99.90)

Surface sea water, Beibu Gulf, China

 

-

-

JL 1463

Erythrobacter pelagi UST081027–248 (98.48)

Surface sea water, South China sea, China

 

-

-

JL 883

Erythrobacter flavus SW-46 (99.79)

Surface sea water, Taiwan strait, China

 

-

-

JL 923

Erythrobacter flavus SW-46

(99.25)

Surface sea water, South China sea, China

 

-

-

JL 1833

Erythrobacter flavus BL16 (100.00)

Bottom sea water, South China sea, China

 

-

-

JL 1408

Erythrobacter flavus SW-46 (99.89)

Surface sea water, South China sea, China

 

-

-

JL 917

Erythrobacter citreus RE35F/1 (99.72)

Surface sea water, Taiwan strait, China

 

-

-

JL 1317

Erythrobacter flavus SW-46 (99.01)

Surface sea water, South China sea, China

 

-

-

JL 658–2

Erythrobacter citreus RE35F/1 (99.66)

Surface sea water, Taiwan strait, China

 

-

-

Roseobacter denitrificans OCh114 DSM 7001*

 

Seaweed, Japan

[52]

-

-

Dinoroseobacter shibae DFL12*

 

Cells of Prorocentrum lima

[53]

-

-

Citromicrobium bathyomarinum JL 354

 

Surface sea water, South China sea, China

 

-

-

JL 1363

Citromicrobium sp. (100.00)

Upper sea water (50 m), South China sea, China

 

-

-

JL 2210

Lutibacterium sp. (100.00)

Surface sea water, Atlantic Ocean

 

-

-

JL 1614

Halomonas sp. (100.00)

Surface sea water, Pacific Ocean

 

-

-

*strains were purchased from DSMZ (the German Resource Center for Biological Material), Germany. +, cell lysis; −, no effect

Isolation of the phage

Phage vB_EliS-R6L was isolated from seawater obtained in March 2014 off the coast of Xiamen, China (118°04′ E, 24°31′ N), using standard virus enrichment and double-layer agar methods. Briefly, E. litoralis DSM 8509 (100 mL) was co-cultured with a pre-filtered (0.22-μm membrane filter; Millipore, USA) seawater sample (20 mL) for 24 h at 30 °C. The culture was filtered again and serially diluted to determine phage activity using a double-layer agar method [25]. A single plaque was collected from the plate using a sterile pipette (Fisher, Canada) and then purified four successive times using the double-layer agar method. Following purification, stock cultures of the phage were prepared using sodium chloride-magnesium sulfate (SM) buffer (100 mM NaCl, 50 mM Tris, 10 mM MgSO4, and 0.01% gelatin, pH 7.5) supplemented with several drops of chloroform and stored at 4 °C and −80 °C.

Transmission electron microscopy (TEM)

For TEM analysis, 1 L of E. litoralis DSM 8509 culture (OD600 = 0.5) was inoculated with the phage at a multiplicity of infection of 10 and cultivated for 24 h at 30 °C. The mixture was centrifuged at 6000×g for 10 min, and the upper aqueous phase was filtered through a 0.22-μm membrane and precipitated with 10% (w/v) dissolved polyethylene glycol 8000 (containing 1 M NaCl). After >8 h at 4 °C, the mixture was centrifuged at 10,000×g for 50 min at 4 °C, and the pellet was gently resuspended in 5 mL of SM buffer. The phages were then purified by CsCl gradient ultra-centrifugation (gradient-density: 1.5 g/mL, 200,000×g, 24 h, 4 °C; Optima L-100 XP Ultracentrifuge, Beckman Coulter). The purified phage particles were collected and dialyzed twice in SM buffer; 20 μL of suspension was added dropwise onto a copper grid and negatively stained with 2% aqueous uranyl acetate for 10 min. Transmission electron micrographs were obtained using a JEM-2100HC transmission electron microscope (JEOL, Japan) at an accelerating voltage of 120 kV. The phage size was calculated from at least 20 particles.

Chloroform sensitivity

To determine whether phage vB_EliS-R6L contains lipids, its sensitivity to chloroform was examined as described previously [26]. Briefly, 500 μL of the phage suspension (~109 plaque forming units (PFU)/mL) were mixed with 5 μL, 50 μL, or 500 μL of chloroform, vigorously shaken for 2 min, and then incubated at 30 °C for 30 min. The samples were immediately diluted and plated for phage titration using double-layer agar plates inoculated with E. litoralis DSM 8509.

Host range analysis

To investigate the host range of phage vB_EliS-R6L, plaque assays were performed on 27 marine bacterial strains, including 21 Erythrobacter strains, two Citromicrobium strains, and one each of the genera Roseobacter, Dinoroseobacter, Lutibacterium, and Halomonas (Table 1). The host range was determined by adding 5 μL of a diluted phage suspension (~107 PFU/mL) dropwise onto the surface of double-layer agar plates inoculated with the bacterial strain of interest. The plates were incubated at 30 °C for up to 7 days, and plaque formation was assessed repeatedly during this period. The efficiency of plating (EOP) of susceptible strains was quantified by calculating the ratio of the PFU obtained with each phage-susceptible strain to the PFU obtained with E. litoralis DSM 8509. All assays were carried out in triplicate.

One-step growth assays

One-step growth curve experiments were performed as previously described [25, 27]. Briefly, mid-exponential phase E. litoralis DSM 8509 (optical density at 600 nm = 0.3–0.5, 100 mL) was inoculated with phage at a multiplicity of infection of 0.01 and allowed to adsorb for 10 min at 30 °C. The mixture was then centrifuged at 6000×g for 10 min to remove non-absorbed phage in the supernatant; the pelleted cells were resuspended in 100 mL of RO medium, followed by incubation at 30 °C. Two sets of duplicate samples were removed at 20-min intervals for 6 h, and chloroform (1% final concentration) was added to the second set to release the intracellular phage. The two samples were then diluted and immediately plated for phage titration using the double-layer agar plate method. Another set of cultures without phage inoculation served as the blank control. Samples for optical density (OD600) measurements from both the treated and untreated cultures were removed at the 20-min intervals for 6 h and at 1-h intervals for the next 4 h. The PFU of each sample was calculated by counting the plaques on the bacterial lawn. The assay was performed in triplicate.

Thermal/pH stability

To investigate the thermal stability of the phage, 1 mL of phage vB_EliS-R6L (~10 7 PFU/mL) with SM buffer was incubated for 2 h at 30 °C, 40 °C, 42.5 °C, 45 °C, 50 °C, 60 °C, 70 °C, 75 °C, or 80 °C, after which the phage suspensions were immediately cooled to 4 °C for activity estimation. To evaluate the stability of the phage at different pH levels, RO medium was adjusted to pH 1–14 with sterile 5 M HCl or NaOH solution and then filtered through a 0.22-μm membrane filter (Millipore, USA). Additionally, 1 mL of a phage suspension (~10 7 PFU/mL) prefiltered through a 0.22-μm membrane filter was incubated at 30 °C for 24 h in 9 mL RO medium of different pHs. Phage activity was determined using the double-layer agar method with RO medium (pH 7.5) at 30 °C and assessed by calculating changes in PFU following exposure to the different temperatures and pH levels. All assays were performed in triplicate.

Effects of temperature and pH on infection

To investigate the effect of temperature on phage infection, 5 μL of a phage suspension (~10 9 PFU/mL) was added dropwise onto double-layer agar plates containing E. litoralis DSM 8509 and incubated at 15 °C, 20 °C, 25 °C, 27.5 °C, 30 °C, 35 °C, and 40 °C for 7 days. To investigate the effect of pH on infection, the pH of RO medium was adjusted with 5 M HCl (pH 4–5), 0.2 M Na2HPO4/ NaH2PO4 (pH 6–8) or 0.1 M NaHCO3/Na2CO3 (pH 9–11); after autoclaving, the pH was checked with pH test paper and readjusted if necessary. Next, 5 μL of a phage suspension (~10 9 PFU/mL) was added dropwise onto double-layer agar plates inoculated with host cells at different pH values. The plates were incubated at 30 °C for up to 7 days. All assays were performed in triplicate.

Lysogenic/lytic assays

To investigate whether the phage can integrate onto the genome of its host, 10 μL of a phage suspension (~10 9 PFU/mL) was added dropwise onto double-layer agar plates inoculated with E. litoralis DSM 8509; the center portion within the plaques was carefully pipetted out and inoculated onto a new plate. After two rounds of isolation and purification, 40 randomly selected bacterial colonies were chosen for colony polymerase chain reaction (PCR) using two pairs of primers, designed according to phage genome annotation, targeting ORF 91 (Major capsid protein) (forward primer 5′ –GCTGACCACCAAGCAGATGA - 3′, reverse primer 5′ - CGGAACGAGGCTATCCCAC - 3′, 521 bp) and ORF 100 (Terminase) (forward primer 5′ - TCATGTGGCAGGCTTGGG - 3′, reverse primer 5′ - GGGTCGGTCCAGTCTTTCG - 3′, 549 bp).

Phage DNA extraction, sequencing, and genomic analysis

Using the same sample preparation utilized for TEM analysis, 1 mL of a phage suspension was purified by CsCl density-gradient centrifugation, followed by dialysis. To remove free DNA and RNA, the sample was then digested at 37 °C for 1 h with DNase I and RNase A (Takara) at final concentrations of 1 μg/mL. The solution was incubated with proteinase K and sodium dodecyl sulfate at final concentrations of 100 μg/mL and 1% (w/v), respectively, at 55 °C for 2 h. After incubation, the solution was extracted twice with phenol:chloroform:isoamyl alcohol (25:24:1) and once with chloroform:isoamyl alcohol (24:1), after which the solutions were precipitated with sodium acetate and precooled ethanol at final concentrations of 1/10 and 1/1 (v/v), respectively. After overnight incubation at −20 °C, DNA was collected by centrifugation and successively washed twice with precooled 70% and 100% ethanol. The genomic DNA of vB_EliS-R6L was sequenced using the Illumina Miseq platform to generate 2 × 251 bp paired-end reads. The reads were assembled using CLC Genomics Workbench software (18,777 × coverage).

Genomic and bioinformatic analyses

The GeneMarkS online server (http://exon.gatech.edu/Genemark/genemarks.cgi), Glimmer 3.0 (http://ccb.jhu.edu/software/glimmer/index.shtml), and the ORF Finder online server (https://www.ncbi.nlm.nih.gov/orffinder/) were used to identify putative open reading frames (ORFs). Genes were annotated using BLAST searches against the NCBI non-redundant (nr) protein database, with a cut-off of E-value ≤10−5. A temperate and/or lytic lifestyle was predicted using the phage classification toolset (PHACTS) online prediction program (http://www.phantome.org/PHACTS/index.php). Methylase ORFs were searched using the REBASER online program (http://rebase.neb.com/rebase/rebase.html).

The amino acid sequences of endolysin protein (ORF 74), major capsid protein (ORF 91), portal protein (ORF 98), and terminase (ORF 100) from phage vB_EliS-R6L were used to construct neighbor-joining phylogenetic trees with MEGA 6.06 and 200 bootstrap replications. For use in the phylogenetic analysis, the amino acid sequences of these four proteins from closely related phages were retrieved from GenBank.

Genome recruitment

To explore the geographic distribution of vB_EliS-R6L-like phages, the amino acid sequences of the phage ORFs were employed as queries to search against metagenomic databases of the Jiulong River Estuary (JRE), Xiamen, China [28], the Pacific Ocean Virome (POV) and Global Ocean Survey (GOS) (http://data.imicrobe.us/) using tBLASTn at a cut-off of E-value ≤10−5, an alignment value ≥30 and a score value ≥40. The count abundance of each read was normalized by dividing by the number of total reads in the database and the size of the gene product [20].

Nucleotide sequence accession number

The genome sequence of phage vB_EliS-R6L was deposited in the GenBank database under accession number KY006853.

Results and discussion

Phage isolation and basic characterization

To the best of our knowledge, vB_EliS-R6L is the first phage isolated from the ecologically important marine bacteria of the genus Erythrobacter. vB_EliS-R6L forms small, clear, round (1–4 mm diameter) plaques on a bacterial lawn (Fig. 1). After treatment with different concentrations of chloroform (i.e., 1%, 10%, and 100% (v/v)), the phage showed survival rates of 94.7 ± 4.9%, 83.1 ± 2.5%, and 81.9 ± 1.9%, respectively, indicating that vB_EliS-R6L may not sensitive to chloroform or contain lipids. TEM micrographs revealed that it belongs to the siphovirus family, with an icosahedral capsid 75.9 ± 2.2 nm in diameter and a characteristically long tail of 165.6 ± 2.3 nm (Fig. 1).
Fig. 1

Plaque (a) and TEM (b) images of Erythrobacter litoralis DSM 8509 phage vB_EliS-R6L particles. The scale bar (b) equals 100 nm

Of all the strains tested, phage vB_EliS-R6L could only infect E. litoralis DSM 8509 and E. longus DSM 6997, the only strains for each species that could be obtained from public culture collections. Of the commonly isolated three-tailed phage families (Myoviridae, Siphoviridae, and Podoviridae), Myoviridae phages have a broader host range than species of the other two families. Therefore, it was not unexpected that a narrow host range was observed for phage vB_EliS-R6L. Based on whole-genome comparison, Zheng et al. (2016) reported that Erythrobacter strains cluster into three groups, with strains DSM 8509, DSM 6997, and JL 475 belonging to the same group. These three strains share high 16S rRNA gene identity (> 97%) but can be discriminated by average nucleotide identity analysis [11]. Integrative and conjugative element analysis showed that DSM 8509 and DSM 6997 cluster closely together and away from JL 475, suggesting asynchronous evolution. This may account for the ability of phage vB_EliS-R6L to infect DSM 8509 and 6997 but not JL 475. In addition, previous studies have suggested that the number of tRNAs can be positively correlated with host range due to compensation for different codon usage patterns in host bacteria [29]. No tRNAs were identified in the phage vB_EliS-R6L genome using tRNAscan-SE (1.3.1) software [30], which may also account for its relatively narrow host range. In lysogenic/lytic assays, 17.5% (7/40) of bacterial isolates from the center portion of plaques showed positive PCR amplification using primers specific for phage ORFs. This finding suggests that vB_EliS-R6L may integrate into its host cell and possibly enter into a lysogenic life cycle, which is consistent with our bioinformatic analysis (see below).

According to one-step growth curve experiments, the eclipse and latent periods of phage infection occurred at 2 h 40 min and 3 h post-infection, respectively (Fig. 2). The burst size was ~86 PFU/cell, similar to the latent period and burst size of most phages infecting Roseobacter species, ranging from <1–6 h and 27–1500 PFU/cell, respectively [23, 3133]. Stability assessment showed that over 60% of vB_EliS-R6L phage remained active at temperatures up to 50 °C (2 h treatment) and that <1% remained active at temperatures >70 °C (Fig. 3). In addition, the phage survival rate was greater than 77% after 24 h at pH 6, 7, or 8 (Fig. 3). Although vB_EliS-R6L retained some activity after 24 h at pH 3 (39%) and pH 12 (10%), activity was lost below pH 2 or above pH 13. An infection condition test showed that phage vB_EliS-R6L could infect E. litoralis DSM 8509 and form clear plaques on plates within 2 days at 25 °C ~ 35 °C. Visible plaques appeared on plates after 4 days at 15 °C and 20 °C, whereas no clear plaques were visible at 40 °C after 7 days of incubation. In addition, plaques were observed in the infection test within a pH range of 7–10. These data showed phage vB_EliS-R6L particles to be stable, with broad temperature and pH tolerance compared to most isolated phages [34], characteristics that might offer more survival opportunities in the diverse marine environment. However, phage vB_EliS-R6L was only able to successfully proliferate within a relatively narrow range of conditions (i.e., < 40 °C, pH 7–10). Unsuccessful infection might be a consequence of thermal/chemical alterations to the phage structure or host receptors [35, 36], and further investigation is needed.
Fig. 2

One-step growth curve analysis of Erythrobacter litoralis phage vB_EliS-R6L. (a) the Plaque forming Unints (PFUs) of the phage and (b) the optical density (OD600) of Erythrobacter litoralis DSM 8509. Open circles (a), chloroform-treated samples; closed circles (a), non-chloroform-treated samples. Open circles (b), without phage-inoculated samples; closed circles (b), phage-inoculated samples. OD, optical density

Fig. 3

Stability of Erythrobacter litoralis phage vB_EliS-R6L under various stress conditions. (a) pH stability and (b) temperature stability. PFU, Plaque Forming Unit. Error bars show standard deviations among triplicate samples

Genomic analysis of phage vB_EliS-R6L

The complete dsDNA genome of phage vB_EliS-R6L is 65,675 bp in size (GenBank accession no. KY006853). The overall G + C content is 66.5%, similar to that of its host (i.e., 65.2%, GenBank accession no. NZ_CP017057). A total of 108 ORFs were identified (Table 2), and identity of the predicted coding sequences with sequences available in GenBank is low (26–77% at the amino acid level). Homologous sequences in the NCBI non-redundant protein database were found for 58 gene products; however, only 29 had predicted functions (Table 2), 19 of which have been assigned to known functional domain categories. In total, 27 ORFs are homologous with previously identified bacteriophage genes, and 15 are homologs of proteins from siphophage-infecting Alphaproteobacteria. Overall, as suggested by the low degree of coverage (< 3%) of the entire genome sequence identified by BLASTn analysis, the vB_EliS-R6L genome is largely unique compared with other published phage genomes.
Table 2

Erythrobacter litoralis DSM 8509 phage vB_EliS-R6L genome annotations (KY006853)

Gene

Strand

Start (bp)

Stop (bp)

Residue length (nn)

Residue length (aa)

Putative function/feature

Best matched evidence or organism

Homolog Accession Num.

% Id

BlastP E-Value

1

-

<3

2423

2421

830

DNA modification methylase

uncultured Mediterranean phage uvMED

BAQ92410

55

2.00E-47

2

-

2420

2875

456

151

hypothetical protein (DNA polymerase III beta clamp)

Methylobacterium sp. ARG-1 (Caulobacter phage Sansa)

WP_050734237 (AKU43506)

49 (27)

7.00E-11 (3.00E-04)

3

-

2883

3239

357

118

hypothetical protein

None

n/a

n/a

n/a

4

-

3286

3456

171

56

hypothetical protein

None

n/a

n/a

n/a

5

-

3453

3614

162

53

hypothetical protein

None

n/a

n/a

n/a

6

-

3601

3813

213

70

hypothetical protein

None

n/a

n/a

n/a

7

-

3810

4853

1044

347

phosphoadenosine phosphosulfate reductase

Sphingomonas sp. LH128

WP_008827527

49

3.00E-85

8

-

4835

5023

189

62

hypothetical protein

None

n/a

n/a

n/a

9

-

5020

5628

609

202

molecular chaperone

Caulobacter phage Sansa

AKU43478

41

5.00E-42

10

-

5674

6315

642

213

hypothetical protein

Pseudomonas oryzihabitans

WP_044342705

55

2.00E-63

11

-

6322

6558

237

78

hypothetical protein

None

n/a

n/a

n/a

12

-

6537

6791

255

84

hypothetical protein

Sphingomonas sp. Ant H11

WP_052192475

52

3.00E-23

13

-

6791

7174

384

127

hypothetical protein

uncultured Mediterranean phage uvMED (Caulobacter phage Sansa)

BAR28076 (AKU43468)

39 (27)

5.00E-08 (7.00E-04)

14

-

7171

7473

303

100

hypothetical protein

None

n/a

n/a

n/a

15

-

7473

7904

432

143

hypothetical protein

None

n/a

n/a

n/a

16

-

7901

8050

150

49

hypothetical protein

None

n/a

n/a

n/a

17

-

8047

8397

351

116

hypothetical protein

None

n/a

n/a

n/a

18

-

8394

8933

540

179

hypothetical protein

None

n/a

n/a

n/a

19

-

8933

9061

129

42

hypothetical protein

None

n/a

n/a

n/a

20

-

9061

9198

138

45

hypothetical protein

None

n/a

n/a

n/a

21

-

9195

9422

228

75

hypothetical protein

None

n/a

n/a

n/a

22

-

9419

9679

261

86

hypothetical protein P106B_62

Rhizobium phage vB_RglS_P106B

YP_009005988

47

2.00E-08

23

-

9733

10,005

273

90

hypothetical protein

None

n/a

n/a

n/a

24

-

10,005

10,118

114

37

hypothetical protein

None (Caulobacter phage Sansa)

n/a (AKU43430)

n/a (27)

n/a (2.00E-06)

25

-

10,115

10,603

489

162

hypothetical protein

None

n/a

n/a

n/a

26

-

10,596

11,546

951

316

hypothetical protein

Rhizobium tropici

WP_052227599

45

1.10E-02

27

-

11,697

12,263

567

188

hypothetical protein

Sphingomonas sp. Y57

WP_053000396

41

3.00E-31

28

-

12,278

12,880

603

200

hypothetical protein

Novosphingobium sp. ST904

WP_054436273

39

3.00E-23

29

-

12,867

13,688

822

273

hypothetical protein

Erythrobacter sp. SG61-1 L

WP_054529722

40

3.00E-10

30

-

13,961

14,176

216

71

hypothetical protein

None

n/a

n/a

n/a

31

-

14,173

14,859

687

228

hypothetical protein

Lactobacillus phage LL-H

YP_001285924

43

1.00E-18

32

-

14,856

15,137

282

93

acyl carrier protein

Ruminococcus albus

WP_037276568

44

6.00E-13

33

-

15,195

15,818

624

207

hypothetical protein

Sphingomonas wittichii

WP_016745765

29

6.00E-10

34

-

15,808

16,488

681

226

methyltransferase

Caulobacter phage Sansa

AKU43482

31

2.00E-08

35

-

16,488

16,703

216

71

hypothetical protein

None

n/a

n/a

n/a

36

+

16,834

17,106

273

90

hypothetical protein

None

n/a

n/a

n/a

37

+

17,106

17,384

279

92

hypothetical protein

None

n/a

n/a

n/a

38

+

17,381

17,662

282

93

hypothetical protein

None

n/a

n/a

n/a

39

+

17,664

17,909

246

81

hypothetical protein

None

n/a

n/a

n/a

40

+

17,986

18,774

789

262

type I restriction-modification system methyltransferase subunit-like protein

Methylobacterium nodulans ORS 2060

YP_009126070

41

2.71E-44

41

+

18,774

20,180

1407

468

nucleoside triphosphate hydrolase

Caulobacter phage Sansa

AKU43472

37

1.00E-59

42

+

20,177

20,440

264

87

hypothetical protein

Sphingomonas sp. BHC-A

WP_025772726

51

1.00E-13

43

+

20,437

20,730

294

97

hypothetical protein

None

n/a

n/a

n/a

44

+

20,723

20,983

261

86

hypothetical protein

None

n/a

n/a

n/a

45

+

20,980

22,629

1650

549

nucleic acid-binding protein

Caulobacter phage Sansa

AKU43470

30

2.00E-12

46

+

22,626

23,351

726

241

exonuclease

Sphingobium baderi LL03 (Caulobacter phage Sansa)

KMS62764 (AKU43467)

46 (35)

8.00E-64 (1.00E-22)

47

+

23,341

24,513

1173

390

ERF family protein

Dunaliella viridis virus SI2

YP_009021005

31

1.00E-19

48

+

24,513

24,677

165

54

hypothetical protein

None

n/a

n/a

n/a

49

+

24,677

25,180

504

167

single-stranded DNA-binding protein

Citromicrobium (Caulobacter phage Sansa)

WP_010236565 (AKU43479)

63 (52)

2.00E-56 (1.00E-52)

50

+

25,192

26,049

858

285

phage Gp37Gp68 (ssDNA-annealing protein)

Sphingomonas sp. Y57 (Caulobacter phage Sansa)

WP_047169428 (AKU43469)

52 (30)

3.00E-89 (9.00E-05)

51

+

26,046

26,573

528

175

hypothetical protein

None

n/a

n/a

n/a

52

+

26,598

27,239

642

213

hypothetical protein

None (Caulobacter phage Sansa)

n/a (AKU43520)

n/a (23)

n/a (3.00E-04)

53

+

27,232

27,639

408

135

hypothetical protein

Sphingobium chungbukense

WP_046763480

43

7.00E-15

54

-

27,873

28,238

366

121

hypothetical protein

Pseudomonas aeruginosa

WP_052157666

48

2.00E-11

55

+

28,309

28,692

384

127

cytosine-specific methyltransferase

Ralstonia solanacearum GMI1000

NP_518991

48

7.98E-23

56

+

28,730

28,918

189

62

hypothetical protein

None

n/a

n/a

n/a

57

+

28,918

29,508

591

196

hypothetical protein

None

n/a

n/a

n/a

58

+

29,612

30,007

396

131

hypothetical protein

None

n/a

n/a

n/a

59

+

30,092

30,574

483

160

hypothetical protein

None

n/a

n/a

n/a

60

+

30,574

30,828

255

84

hypothetical protein

None

n/a

n/a

n/a

61

+

30,903

31,304

402

133

MucR family transcriptional regulator

Methylobacterium nodulans

WP_012631401

55

3.00E-33

62

+

31,301

31,687

387

128

hypothetical protein

None

n/a

n/a

n/a

63

+

31,684

31,902

219

72

hypothetical protein

None

n/a

n/a

n/a

64

+

31,893

32,033

141

46

hypothetical protein

None

n/a

n/a

n/a

65

+

32,020

32,235

216

71

hypothetical protein

None

n/a

n/a

n/a

66

+

32,235

32,468

234

77

hypothetical protein

None

n/a

n/a

n/a

67

+

32,465

33,223

759

252

DNA methylase

Mycobacterium phage Llama

AIM51011

56

2.00E-51

68

+

33,259

33,612

354

117

hypothetical protein

Vibrio phage VvAW1

YP_007518376

44

2.00E-20

69

+

33,662

33,958

297

98

hypothetical protein

Burkholderia vietnamiensis

WP_011875349

34

1.00E-05

70

+

33,955

34,455

501

166

hypothetical protein

Novosphingobium sp. KN65.2

CDO34010

41

4.00E-22

71

-

34,717

34,962

246

81

hypothetical protein

Sphingomonas sanxanigenens

WP_025293719

52

5.00E-22

72

-

35,015

35,344

330

109

hypothetical protein

Sphingomonas sanxanigenens

WP_025293718

55

1.00E-08

73

-

35,316

35,633

318

105

hypothetical protein

None

n/a

n/a

n/a

74

-

35,630

36,505

876

291

endolysin

Caulobacter phage Sansa

AKU43454

50

2.00E-39

75

-

36,552

36,776

225

74

hypothetical protein

Sphingomonas sp. ATCC 31555

WP_019371220

68

2.00E-12

76

-

36,935

37,528

594

197

hypothetical protein

Sphingomonas sp. ATCC 31555

WP_019371221

44

2.00E-34

77

-

37,589

39,856

2268

755

D-alanyl-D-alanine carboxypeptidase

Methyloceanibacter caenitepidi

BAQ15659

33

2.00E-25

78

-

39,853

40,308

456

151

hypothetical protein

Delftia sp. RIT313

WP_052155377

54

2.00E-27

79

-

40,309

43,059

2751

916

virion structural protein

Pseudomonas phage PaMx28

ALH23633

44

0.00E + 00

80

-

43,088

43,282

195

64

tail assembly protein

Burkholderia phage AH2

YP_006561132

53

1.00E-15

81

-

43,279

43,509

231

76

virion structural protein

Pseudomonas phage PaMx25

ALH23804

77

5.00E-17

82

-

43,509

44,288

780

259

virion structural protein

Pseudomonas phage PaMx28

ALH23630

48

2.00E-72

83

-

44,285

45,874

1590

529

tail assembly structural protein

Pseudomonas phage MP1412

YP_006561079

35

1.00E-55

84

-

45,871

49,170

3300

1099

tail tape-measure protein

Paracoccus phage vB_PmaS_IMEP1

YP_009126438

51

3.00E-41

85

-

49,462

49,974

513

170

hypothetical protein

Roseobacter phage RDJL Phi 2

AKQ75858

26

8.00E-06

86

-

50,038

51,579

1542

513

major capsid protein

Roseobacter phage RDJL Phi 1

YP_004421846

46

3.00E-138

87

-

51,592

52,032

441

146

phage structural protein

Roseobacter phage RDJL Phi 1

YP_004421845

30

9.05E-13

88

-

52,029

52,526

498

165

virion structural protein

Pseudomonas phage PaMx25

ALH23810

34

6.00E-06

89

-

52,530

53,045

516

171

hypothetical protein

None

n/a

n/a

n/a

90

-

53,136

54,083

948

315

hypothetical protein

Caulobacter phage Sansa

AKU43432

61

9.00E-06

91

-

54,105

55,115

1011

336

major capsid protein E

Pseudomonas phage KPP23 (Caulobacter phage Sansa)

BAO53114 (AKU43431)

32 (24)

8.00E-39 (9.00E-12)

92

-

55,201

55,578

378

125

hypothetical protein

None

n/a

n/a

n/a

93

-

55,624

56,901

1278

425

hypothetical protein

Roseobacter phage RDJL Phi 2

AKQ75851

38

3.00E-21

94

-

56,891

57,370

480

159

hypothetical protein

Roseobacter phage RDJL Phi 2

AKQ75850

46

1.00E-23

95

-

57,494

58,489

996

331

head morphogenesis protein

Roseobacter phage RDJL Phi 2 (Caulobacter phage Sansa)

AKQ75849 (AKU43427)

49 (25)

4.00E-80 (7.00E-26)

96

-

58,494

58,892

399

132

hypothetical protein IB60_17100

Brucella abortus LMN1

KFH18426

31

5.00E-08

97

-

58,892

59,431

540

179

hypothetical protein (tail protein)

Roseobacter phage RDJL Phi 2 (Caulobacter phage Sansa)

AKQ75847 (AKU43445)

34 (57)

2.00E-09 (1.00E-03)

98

-

59,431

60,993

1563

520

portal protein

Caulobacter phage Sansa

AKU43426

25

5.00E-18

99

-

61,152

61,415

264

87

hypothetical protein

None

n/a

n/a

n/a

100

-

61,878

63,512

1635

544

terminase

Agrobacterium rhizogenes

WP_051696780

56

3.00E-148

101

-

63,493

64,023

531

176

hypothetical protein

Nitratireductor basaltis

WP_051913838

30

6.00E-07

102

+

64,145

64,327

183

60

hypothetical protein

None

n/a

n/a

n/a

103

+

64,371

64,556

186

61

hypothetical protein

None

n/a

n/a

n/a

104

+

64,553

64,687

135

44

hypothetical protein

None

n/a

n/a

n/a

105

+

64,747

65,037

291

96

hypothetical protein

None

n/a

n/a

n/a

106

+

65,037

65,204

168

55

hypothetical protein

None

n/a

n/a

n/a

107

+

65,233

65,520

288

95

hypothetical protein

None

n/a

n/a

n/a

108

+

65,532

65,675

144

47

hypothetical protein

None

n/a

n/a

n/a

Eight genes were found to encode proteins related to DNA metabolism. In addition to DNA modification methylase (ORF 1) and DNA methylase (ORF 67), phage vB_EliS-R6L encodes another three methylase proteins, including a methyltransferase (ORF 34), a type I restriction-modification (R-M) system methyltransferase subunit-like protein (ORF 40), and a cytosine-specific methyltransferase (ORF 55). The identities range from 31 to 56% (46% on average). Four of the five ORFs are predicted to contain a single domain, including a CcrM-like domain (ORF 1, with recognition site of GANTC), two SAM methyltransferase domains (COMT-like) (ORF 34 and 40, a versatile enzyme with various target molecules), and a Dam subfamily domain (ORF 67, with a recognition site of GATC). Methyltransferases are ubiquitous in prokaryotic genomes, and these enzymes are often associated with a cognate restriction endonuclease, forming an R-M system that protects bacterial cells from invasion by foreign DNA such as phages. Approximately 20% of annotated phage genomes encode methylases, and it is proposed that they may help the phage overcome R-M and other phage-targeted resistance systems in the host and prolong the effectiveness of infection [37]. As predicted by REBESE software, one R-M pair was recognized in the genome of E. litoralis DSM 8509 (with the recognition site CCGGAG), and five pairs were found for E. longus DSM 6997 (two of which have recognition sites GGCGCC and CGATCG; the other three have no recognition sites). Those R-M recognition sites indicate 37 potential cleavage sites (23 for CCGGAG, 14 for CGATCG) in the genome of phage vB_EliS-R6L. The predicted recognition site GATC of ORF 67 in the phage genome agrees with the R-M sites of DSM 6997, demonstrating the potential to overcome the host R-M system. Previous studies also found that phage T4 encodes a DAM methylase that targets GATC sites, protecting the phage DNA from an R-M system that recognizes this sequence [38]. Based on REBASE searches, 1051 homologs matched with the five methylase proteins, suggesting that R6L-like methylases are widespread, which may enhance infectivity and evasion of the host R-M system. Phage vB_EliS-R6L may represent a good model for exploitation of phage methylases and marine host-phage interactions. Moreover, Dziewit et al. (2014) suggested that methylases may account for differences in the methylation state and induce host transcriptional changes that are essential for the phage life cycle [39].

Twelve ORFs are predicted to encode proteins involved in the structure and assembly of virions, nine of which are homologous to genes from Pseudomonas (Gammaproteobacteria) and/or Roseobacter isometric siphophages [21, 40, 41]. A further four conjunctive ORFs with unknown functions also exhibit homology to these phage types. This is consistent with the results of the phylogenetic trees generated using major capsid protein and portal protein amino acid sequences (Fig. 4). However, it is noteworthy that except for these 13 ORFs, no other ORFs of vB_EliS-R6L show a high degree of homology to Pseudomonas or Roseobacter isometric phage sequences. It therefore appears that genes associated with the structural architecture of phage vB_EliS-R6L are relatively conserved and may have evolved independently from other genes in the genome. Moreover, the low protein identity predicted between phage vB_EliS-R6L and those homologies (26–77%, 41% on average), as well as clearly distant phylogenetic relationships (Fig. 4), suggest that phage vB_EliS-R6L exchanged genetic material with those closely related phages prior to a distinct evolutionary path.
Fig. 4

Phylogenetic relationships of four genes of vB_EliS-R6L-like phages. The neighbor-joining trees were based on the ClustalW alignment of amino acid sequences by MEGA 6.06. The bootstrap values were based on 200 replicates. (a) terminase; (b) endolysin; (c) portal protein; (d) major capsid protein

One putative endolysin gene (ORF 74) and one molecular chaperone (ORF 9) were identified in the genome of vB_EliS-R6L, sharing 50% and 41% amino acid identity, respectively, with the corresponding proteins of the Caulobacter phage Sansa [42]. Most tailed phages achieve lysis via consecutive use two essential proteins, endolysin and holin (which control the length of the infective cycle). Endolysins are phage-encoded enzymes that degrade bacterial peptidoglycan. ORF 74 is predicted to contain one domain: a 176-aa region near the C-terminus that shows homology to proteins of the lysozyme-like superfamily. Although Caulobacter phage Sansa contains a lysis cassette (a holin/anti-holin pair and an endolysin) [42], none of the ORFs identified in phage vB_EliS-R6L exhibit homology to holin proteins. This may be the result of the limited number of holin protein sequences in databases [43, 44]. In addition, ORF 9 is predicted to contain one 49-aa domain homologous to chaperone J, which assists in translation.

Three ORFs are predicted to code for an acyl carrier protein (ORF 32), a nucleoside triphosphate hydrolase (ORF 41), and a phosphoadenosine phosphosulfate reductase (ORF 7). The acyl carrier protein in bacteria is responsible for fatty acid biosynthesis, requiring 4′-phosphopantetheine as a covalently attached cofactor. Acyl carrier protein homologs have also been identified in several other phages [45], though their function remains unclear. ORF 41 of phage vB_EliS-R6L is predicted to include a 292-aa P-loop domain of nucleoside triphosphate hydrolases, which hydrolyze the beta-gamma phosphate bond of a bound nucleoside triphosphate, providing energy for viral metabolism. ORF 7 shows 49% identity to phosphoadenosine phosphosulfate reductases, which have been identified in phages such as Lactobacillus phage AQ113 (GenBank accession no. HE956704) [46], Mycobacterium phage Baka (GenBank accession no. JF937090) [47], and Pseudoalteromonas phage PHS3 (GenBank accession no. KX912252, unpublished). Phosphoadenosine phosphosulfate reductases are thought to be involved in sulfate activation for cysteine biosynthesis. However, no studies have investigated the relationship between the activity of these enzymes and phage metabolism [46, 47].

Based on NCBI BLAST gene annotation results, phage vB_EliS-R6L shares 12 similar ORFs (E-value <10 5) with the Caulobacter phage Sansa, and another 5 pairs with an E-value <10 3 were found [42] (Table 2). The 12 homologous ORFs include 3 involved in DNA metabolism, 3 structural proteins, 1 methylase, 1 endolysin, 1 nucleoside triphosphate hydrolase, 1 molecular chaperone and 2 proteins of unknown function. However, the identities of the 12 pairs are not high (ranging from 23 to 61%; 34% on average), providing further evidence for the novelty of phage vB_EliS-R6L.

Endolysin protein (ORF 74), major capsid protein (ORF 91), portal protein (ORF 98), and terminase (ORF 100) were chosen for phylogenetic tree construction (Fig. 4). With the exception of the tree based on the terminase protein, in all cases, vB_EliS-R6L clusters with virulent bacteriophages, such as the Caulobacter phage Sansa, roseophages, and Pseudomonas phages. However, the clearly distant phylogenetic relationships with other phages suggest that vB_EliS-R6L is a novel phage. In the terminase-based tree, phage vB_EliS-R6L is located near prophages from Agrobacterium rhizogenes and Rhizobium freirei, agreeing with the BLASTp analysis. In addition, the phage life style predicted by the PHACTS algorithm indicated that it may be a temperate phage. However, no integrase, repressor, or other genes related to the SOS response [48] were identified in the genome of phage vB_EliS-R6L.

Environmental distribution

Metagenomic analysis indicated that vB_EliS-R6L-like phages are widespread in the examined environmental samples (Fig. 5). Across all metagenomic samples (JRE, POV and GOS), 7138 reads were successfully assigned and detected at rates of 10 9 to 10 7 per amino acid pair in the databases. The greatest matches were found in JRE (1.13 × 10 7 per pair), from which phage vB_EliS-R6L was isolated, followed by POV (1.94 × 10 8 per pair) and GOS (1.89 × 10 8 per pair) coastal samples. This is in agreement with the general distribution of Erythrobacter in the costal environment [1, 2, 49]. Forty-five ORFs were matched to homologs in the databases. The most relative abundant distribution was for ORF 49 (single-stranded DNA-binding protein, with function of DNA replication/repair, 5.28 × 10 9 per pair), ORF 54 (hypothetical protein, 3.05 × 10 9 per pair), ORF 32 (acyl carrier protein, 3.18 × 10 9 per pair) and ORF 100 (terminase, 5.07 × 10 10 per pair). Although the homologs of some ORFs (e.g., 9, 37, 45, 76, 81, 93 and 96) were only found in the JRE virome and/or the POV and GOS coastal samples, the hits for the most matched ORFs covered all three databases. This result suggests that vB_EliS-R6L is a previously unknown phage group that is widely distributed in the marine environment and that it could serve as a good reference for the taxonomic binning of marine viromes in the future.
Fig. 5

Relative abundance of vB_EliS-R6L -like phage genes in the metagenomes. (a) Heatmap of the normalized relative abundance of vB_EliS-R6L ORFs identified in the Jiulong River Estuary, Xiamen, China (JRE), Pacific Ocean Virome (POV) and Global Ocean Survey (GOS). (b) Normalized relative abundance of ORF 32, 49, 54 and 100 in the metagenomes

Conclusion

Phage vB_EliS-R6L is the first virus identified that can infect marine bacteria belonging to the genus Erythrobacter. The phage has a wide temperature and pH tolerance. With a 65.7-kb genome encoding 108 putative gene products, phage vB_EliS-R6L is novel among the cultured phage community and is largely different than all other known phages. Phage vB_EliS-R6L encodes five methylase proteins, suggesting the potential to overcome host resistance systems. Auxiliary metabolic genes in the phage genome were also annotated, such as those coding for an acyl carrier protein and phosphoadenosine phosphosulfate reductases. Metagenomic database queries suggest that vB_EliS-R6L-like phages are widely distributed in the marine environment, especially in coastal waters. Erythrobacter comprises one of the important clades of AAPBs [50, 51] and could represent the predominant AAPBs in the upper oceans [7]. Our study provides the basis for in-depth investigation of host-virus interactions and the ecological behavior of marine Erythrobacter.

Abbreviations

AAPB: 

Aerobic anoxygenic phototrophic bacteria

SM: 

Sodium chloride-magnesium sulfate

TEM: 

Transmission electron microscopy

PFU: 

Plaque forming unit

EOP: 

Efficiency of plating

OD: 

Optical density

PCR: 

Polymerase chain reaction

ORFs: 

Open reading frames

R-M: 

Restriction-modification

JRE: 

Jiulong River Estuary

POC: 

Pacific Ocean Virome

GOS: 

Global Ocean Survey

Declarations

Acknowledgments

We greatly thank Yongle Xu and Luming Yao at Xiamen University for their useful suggestions and help.

Funding

This study was supported by the National Key Basic Research Programs of China (grant NO. 2013CB955700) and the National Natural Science Foundation of China (grant NO. 41522603, 31570172, 91428308).

Availability of data and materials

All data generated or analysed during this study are included in this published article.

Authors’ contributions

LL and LC were responsible for samples collection and phage isolation. LL extracted the viral DNA, sequenced the genome, annotated the genome and carried out the phylogenetic and comparative genomic analyses. LL drafted the manuscript, and RZ, LC and NJ critically revised the manuscript. NJ and RZ organized the study. All authors have read and approved final manuscript.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

Not applicable.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
State Key Laboratory of Marine Environmental Science, Institute of Marine Microbes and Ecospheres, Xiamen University (Xiang’an)

References

  1. Shiba T, Simidu U. Erythrobacter longus gen. Nov., sp. nov., an aerobic bacterium which contains bacteriochlorophyll a. Int J Syst Bacteriol. 1982;32:211–7.View ArticleGoogle Scholar
  2. Kolber ZS, VanDover CL, Niederman RA, Falkowski PG. Bacterial photosynthesis in surface waters of the open ocean. Nature. 2000;407:177–9.View ArticlePubMedGoogle Scholar
  3. Yoon J-H, Kang KH, Oh T-K, Park Y-H. Erythrobacter aquimaris sp. nov., isolated from sea water of a tidal flat of the Yellow Sea in Korea. Int J Syst Evol Microbiol. 2004;54:1981–5.View ArticlePubMedGoogle Scholar
  4. Yoon J-H, Kang KH, Yeo S-H, Oh T-K. Erythrobacter luteolus sp. nov., isolated from a tidal flat of the Yellow Sea in Korea. Int J Syst Evol Microbiol. 2005;55:1167–70.View ArticlePubMedGoogle Scholar
  5. Lei X, Zhang H, Chen Y, Li Y, Chen Z, Lai Q, et al. Erythrobacter luteus sp. nov., isolated from mangrove sediment. Int J Syst Evol Microbiol. 2015;65:2472–8.Google Scholar
  6. Yurkov VV, Beatty JT. Aerobic anoxygenic phototrophic bacteria. Microbiol Mol Biol Rev. 1998;62:695–724.PubMedPubMed CentralGoogle Scholar
  7. Kolber ZS, Plumley FG, Lang AS, Beatty JT, Blankenship RE, VanDover CL, et al. Contribution of aerobic photoheterotrophic bacteria to the carbon cycle in the ocean. Science. 2001;292:2492–5.Google Scholar
  8. Oh H-M, Giovannoni SJ, Ferriera S, Johnson J, Cho J-C. Complete genome sequence of Erythrobacter litoralis HTCC2594. J Bacteriol. 2009;191:2419–20.View ArticlePubMedPubMed CentralGoogle Scholar
  9. Wei J, Mao Y, Zheng Q, Zhang R, Wang Y. Erythrobacter westpacificensis sp. nov., a marine bacterium isolated from the western Pacific. Curr Microbiol. 2013;66:385–90.View ArticlePubMedGoogle Scholar
  10. Zhuang L, Liu Y, Wang L, Wang W, Shao Z. Erythrobacter atlanticus sp. nov., a bacterium from ocean sediment able to degrade polycyclic aromatic hydrocarbons. Int J Syst Evol Microbiol. 2015;65:3714–9.View ArticlePubMedGoogle Scholar
  11. Zheng Q, Lin W, Liu Y, Chen C, Jiao N. A comparison of 14 Erythrobacter genomes provides insights into the genomic divergence and scattered distribution of phototrophs. Front Microbiol. 2016;7:984.View ArticlePubMedPubMed CentralGoogle Scholar
  12. Yurkov V, Stackebrandt E, Holmes A, Fuerst JA, Hugenholtz P, Golecki J, et al. Phylogenetic positions of novel aerobic, bacteriochlorophyll a-containing bacteria and description of Roseococcus thiosulfatophilus gen. Nov., sp. nov., Erythromicrobium ramosum gen. Nov., sp. nov., and Erythrobacter litoralis sp. nov. Int J Syst Bacteriol. 1994;44:427–34.Google Scholar
  13. Röling WFM, Milner MG, Jones DM, Lee K, Daniel F, Swannell RJP, et al. Robust hydrocarbon degradation and dynamics of bacterial communities during nutrient-enhanced oil spill bioremediation. Appl Environ Microbiol. 2002;68:5537–48.Google Scholar
  14. Yurkov V, Jappe J, Vermeglio A. Tellurite resistance and reduction by obligately aerobic photosynthetic bacteria. Appl Environ Microbiol. 1996;62:4195–8.PubMedPubMed CentralGoogle Scholar
  15. Hwang Y-O, Kang SG, Woo J-H, Kwon KK, Sato T, Lee EY, et al. Screening enantioselective epoxide hydrolase activities from marine microorganisms: detection of activities in Erythrobacter spp. Mar Biotechnol. 2008;10:366–73.Google Scholar
  16. Weinbauer MG. Ecology of prokaryotic viruses. FEMS Microbiol Rev. 2004;28:127–81.View ArticlePubMedGoogle Scholar
  17. Suttle CA. Viruses in the sea. Nature. 2005;437:356–61.View ArticlePubMedGoogle Scholar
  18. Suttle CA. Marine viruses-major players in the global ecosystem. Nat Rev Microbiol. 2007;5:801–12.View ArticlePubMedGoogle Scholar
  19. Proctor LM, Fuhrman JA. Viral mortality of marine bacteria and cyanobacteria. Nature. 1990;343:60–2.View ArticleGoogle Scholar
  20. Zhao Y, Temperton B, Thrash JC, Schwalbach MS, Vergin KL, Landry ZC, et al. Abundant SAR11 viruses in the ocean. Nature. 2013;494:357–60.Google Scholar
  21. Huang S, Zhang Y, Chen F, Jiao N. Complete genome sequence of a marine roseophage provides evidence into the evolution of gene transfer agent in alphaproteobacteria. Virol J. 2011;8:124.View ArticlePubMedPubMed CentralGoogle Scholar
  22. Budinoff CR. Diversity and activity of Roseobacters and roseophage. PhD dissertation. Knoxville, TN: University of Tennessee; 2012. http://trace.tennessee.edu/utk_graddiss/1276. Accessed 18 Apr 2017Google Scholar
  23. Zhan Y, Huang S, Voget S, Simon M, Chen F. A novel roseobacter phage possesses features of podoviruses, siphoviruses, prophages and gene transfer agents. Sci Rep. 2016;6:30372.View ArticlePubMedPubMed CentralGoogle Scholar
  24. Fürch T, Preusse M, Tomasch J, Zech H, Wagner-Döbler I, Rabus R, et al. Metabolic fluxes in the central carbon metabolism of Dinoroseobacter shibae and Phaeobacter gallaeciensis, two members of the marine Roseobacter clade. BMC Microbiol. 2009;9:209.Google Scholar
  25. Pajunen M, Kiljunen S, Skurnik M. Bacteriophage φYeO3-12, specific for Yersinia enterocolitica serotype O:3, is related to coliphages T3 and T7. J Bacteriol. 2000;182:5114–20.View ArticlePubMedPubMed CentralGoogle Scholar
  26. Alonso MDC, Rodríguez J, Borrego JJ. Characterization of marine bacteriophages isolated from the Alboran Sea (western Mediterranean). J Plankton Res. 2002;24:1079–87.View ArticleGoogle Scholar
  27. Wu L-T, Chang S-Y, Yen M-R, Yang T-C, Tseng Y-H. Characterization of extended-host-range pseudo-T-even bacteriophage Kpp95 isolated on Klebsiella pneumoniae. Appl Environ Microbiol. 2007;73:2532–40.View ArticlePubMedPubMed CentralGoogle Scholar
  28. Cai L, Zhang R, He Y, Feng X, Jiao N. Metagenomic analysis of virioplankton of the subtropical Jiulong River Estuary, China. Viruses. 2016;doi:10.3390/v8020035.
  29. Hyman P, Abedon ST. Bacteriophage host range and bacterial resistance. Adv Appl Microbiol. 2010;70:217–48.View ArticlePubMedGoogle Scholar
  30. Lowe TM, Eddy SR. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997;25:955–64.View ArticlePubMedPubMed CentralGoogle Scholar
  31. Zhang Y, Jiao N. Roseophage RDJLΦ 1, infecting the aerobic anoxygenic phototrophic bacterium Roseobacter denitrificans OCh114. Appl Environ Microbiol. 2009;75:1745–9.View ArticlePubMedPubMed CentralGoogle Scholar
  32. Zhao Y, Wang K, Jiao N, Chan F. Genome sequences of two novel phages infecting marine Roseobacters. Environ Microbiol. 2009;11:2055–64.View ArticlePubMedPubMed CentralGoogle Scholar
  33. Li B, Zhang S, Long L, Huang S. Characterization and complete genome sequences of three N4-like Roseobacter phages isolated from the South China Sea. Curr Microbiol. 2016;73:409.View ArticlePubMedGoogle Scholar
  34. Mojica KDA, Brussaard CPD. Factors affecting virus dynamics and microbial host–virus interactions in marine environments. FEMS Microbiol Ecol. 2014;89:495–515.View ArticlePubMedGoogle Scholar
  35. Delisle AL, Levin RE. Characteristics of three phages infectious for psychrophilic fishery isolates of Pseudomonas putrefaciens. Antonie Van Leeuwenhoek. 1972;38:1–8.View ArticlePubMedGoogle Scholar
  36. Wiebe WJ, Liston J. Isolation and characterization of a marine bacteriophage. Mar Biol. 1968;1:244–9.View ArticleGoogle Scholar
  37. Murphy J, Maphony J, Ainsworth S, Nauta A, Sinderen DV. Bacteriophage orphan DNA methyltransferases: insights from their bacterial origin, function, and occurrence. Appl Environ Microbiol. 2013;79:7547–55.View ArticlePubMedPubMed CentralGoogle Scholar
  38. Kossykh VG, Schlagman SL, Hattman S. Phage T4 DNA [N6-adenine] methyltransferase: overexpression, purification, and characterization. J Biol Chem. 1995;270:14389–93.View ArticlePubMedGoogle Scholar
  39. Dziewit L, Oscik K, Bartosik D, Radlinska M. Molecular characterization of a novel temperate sinorhizobium bacteriophage, ΦLM21, encoding DNA methyltransferase with CcrM-like specificity. J Virol. 2014;88:13111–24.View ArticlePubMedPubMed CentralGoogle Scholar
  40. Sepúlveda-Robles O, Kameyama L, Guarneros G. High diversity and novel species of Pseudomonas aeruginosa bacteriophages. Appl Environ Microbiol. 2012;78:4510–5.View ArticlePubMedPubMed CentralGoogle Scholar
  41. Liang Y, Zhang Y, Zhou C, Chen Z, Yang S, Yan C, et al. Complete genome sequence of the siphovirus Roseophage RDJLΦ 2 infecting Roseobacter denitrificans OCh114. Mar Genom. 2016;25:17–9.Google Scholar
  42. Vara L, Kana AA, Cahill JL, Rasche ES, Everett GFK. Complete genome sequence of Caulobacter crescentus Siphophage Sansa. Genom Announc. 2015;3:e01131–15.View ArticleGoogle Scholar
  43. Wang I-N, Smith DL, Young R. Holins: the protein clocks of bacteriophage infections. Annu Rev Microbiol. 2000;54:799–825.View ArticlePubMedGoogle Scholar
  44. Saier MH, Reddy BL. Holins in bacteria, eukaryotes, and archaea: multifunctional xenologues with potential biotechnological and biomedical applications. J Bacteriol. 2015;197:7–17.View ArticlePubMedGoogle Scholar
  45. Abbasifar R, Griffiths MW, Sabour PM, Ackermann H-W, Vandersteegen K, Lavigne R, et al. Supersize me: Cronobacter sakazakii phage GAP32. Virology. 2014;46:138–46.Google Scholar
  46. Zago M, Scaltriti E, Rossetti L, Guffanti A, Armiento A, Fornasari ME, et al. Characterization of the genome of the dairy Lactobacillus helveticus bacteriophage ΦAQ113. Appl Environ Microbiol. 2013;79:4712–8.Google Scholar
  47. Hatfull GF. Complete genome sequences of 138 Mycobacteriophages. J Virol. 2012;86:2382–4.View ArticlePubMedPubMed CentralGoogle Scholar
  48. Nanda AM, Thormann K, Frunzke J. Impact of spontaneous prophage induction on the fitness of bacterial populations and host-microbe interactions. J Bacteriol. 2015;197:410–9.View ArticlePubMedPubMed CentralGoogle Scholar
  49. Jiao N, Zhang Y, Zeng Y, Hong N, Liu R, Chen F, et al. Distinct distribution pattern of abundance and diversity of aerobic anoxygenic phototrophic bacteria in the global ocean. Environ Microbiol. 2007;9:3091–9.Google Scholar
  50. Jiao N, Zhang F, Hong N. Significant roles of bacteriochlorophylla supplemental to chlorophylla in the ocean. ISME J. 2010;4:595–7.View ArticlePubMedGoogle Scholar
  51. Stegman MR, Cottrell MT, Kirchman DL. Leucine incorporation by aerobic anoxygenic phototrophic bacteria in the Delaware estuary. ISME J. 2014;8:2339–48.View ArticlePubMedPubMed CentralGoogle Scholar
  52. Swingley WD, Sadekar S, Mastrian SD, Matthies HJ, Hao J, Ramos H, et al. The complete genome sequence of Roseobacter denitrificans reveals a mixotrophic rather than photosynthetic metabolism. J Bacteriol. 2007;189:683–90.Google Scholar
  53. Biebl H, Allgaier M, Tindall BJ, Koblizek M, Lünsdorf H, Pukall R, et al. Dinoroseobacter shibae gen. Nov., sp. nov., a new aerobic phototrophic bacterium isolated from dinoflagellates. Int J Syst Evol Microbiol. 2005;55:1089–96.Google Scholar

Copyright

© The Author(s). 2017

Advertisement