Skip to main content

Table 2 The oligonucleotide primers, amplicon length and amplification efficiency of the real time RT-PCR primers amplifying IFN, Mx, 18S, ISG15 and STAT1 genes

From: Infectious salmon anaemia virus replication and induction of alpha interferon in Atlantic salmon erythrocytes

Primer name Primer sequence Amplicon length (bp) Amplification efficiency
As IFN Fwd1 TGCAGTATGCAGAGCGTGTG 100 1.83
As IFN Rev1 TCTCCTCCCATCTGGTCCAG   
As Mx Fwd TGCAACCACAGAGGCTTTGAA 77 1.88
As Mx Rev GGCTTGGTCAGGATGCCTAAT   
As 18S Fwd TGTGCCGCTAGAGGTGAAATT 60 1.86
As 18S Rev GCAAATGCTTTCGCTTTCG   
As ISG15 Fwd CTGAAAAACGAAAAGGGCCA 100 1.83
As ISG15 Rev GCAGGGACTCCCTCCTTGTT   
As STAT1 Fwd TGTCTGTTGGCTCAGTTGCG 100 1.82
As STAT1 Rev GAAATTGATGCTGTGGCGTCT   
As PKZ Fwd AGATAGCGAAGGCTGTTGGA 101 1.913
As PKZ Rev TGGTTTGTCTGGTGTTGCAT   
  1. 1Primer amplifies SasaIFN-α1 and α2.