Skip to main content

Table 1 Primer and probe sequences used for RT-RAA and RT-qPCR assays

From: Reverse transcription recombinase-aided amplification assay for H5 subtype avian influenza virus

Primer Sequence (5′–3′) Size (bp) Gene Source
H5-F CAGTTTGAGGCYGTTGGAAGGGAATTTAAYAA 32 HA This study
H5-R CTTGTCRTAAAGGTTCTTGACATTTGAGTCAT 32 HA This study
H5-P CTAGATGTCTGGACTTATAATGCTGAACT/i6FAMdT//THF//iBHQ1dT/GGTTCTCATGGAAAAT[C3-spacer] 47 HA This study
H5 + 1456 ACGTATGACTATCCACAATACTCAG 25 HA [13]
H5-1685 AGACCAGCTACCATGATTGC 20 HA [13]
H5 + 1637 FAM-TCAACAGTGGCGAGTTCCCTAGCA-TAMRA 24 HA [13]