Skip to main content

Table 1 Primers and probes of the qq-PCR assay

From: Establishment and evaluation of a quadruple quantitative real-time PCR assay for simultaneous detection of human coronavirus subtypes

Targets Gene NCBI ID of reference sequence Genome position Primer (probe) Sequence (5′–3′) Final concentration (μM)
SARS-CoV-2 S NC_045512.2 25,197–25,324 Primer-F1 GGCCATGGTACATTTGGCT 1.2
     Primer-R1 GCAGCAGGATCCACAAGAA 1.2
     Probe 1 FAM-TTGCTGTAGTTGTCTCAAGGGCTG-BHQ-1 0.6
SARS-CoV-2 and SARS N NC_045512.2 28,677- 28,778 Primer-F2 CTGAGGGAGCCTTGAATACA 1.2
     Primer-R2 TTGGCAATGTTGTTCCTTGA 1.2
     Probe 2 ROX-AACAATGCTGCMAYCGTGCTAC-BHQ-2 0.6
HCoV-229E ORF1ab NC_002645.1 7464–7568 Primer-F3 ACTTTGTCAGTTCGTATGCTAAAC 1.2
     Primer-R3 TTGTCAGAACATTGGCATTAACA 1.2
     Probe 3 Cy5-ATTATCAGCTTATGACTTGGCGTGT-BHQ-2 0.6
HCoV-NL63 ORF1ab NC_005831.2 23,263–23,376 Primer-F4 GTTCTCTTATAGGTGGCATGGT 1.2
     Primer-R4 GAAGCACATCAGTTTGTAAAGCA 1.2
     Probe 4 Cy5-CCTTTTTCTTTGGCACTGCAAGCAC-BHQ-2 0.6
HCoV-HKU1 ORF1ab NC_006577.2 6671–6762 Primer-F5 AGTTTATCTTTAGTTGATGTTTGGGA 1.2
     Primer-R5 GATTTAACTAGGCGTGACAATTCAT 1.2
     Probe 5 Cy5-TATTTGACAGGTTGTGATTATGTTGTTTGGG-BHQ-2 0.6
HCoV-OC43 ORF1ab NC_006213.1 12,518–12,631 Primer-F6 GTGGCCACTAGTTATTATTGCAAA 1.2
     Primer-R6 TCTGGACCACTATTAACAACCTG 1.2
     Probe 6 Cy5-TTGCAAAATAATGAATTAATGCCTGCTAAGTTGA-BHQ-2 0.6
human RNA B2M NM_004048.4 92–238 Primer-F7 TCCAGCGTACTCCAAAGATT 1.2
     Primer-R7 CCACTTTTTCAATTCTCTCTCCATT 1.2
     Probe 7 VIC-TCTGCTGGATGACGTGAGTAAACCTG-BHQ-2 0.6
  1. SARS-CoV-2, severe acute respiratory syndrome coronavirus 2; SARS-CoV, severe acute respiratory syndrome coronavirus; HCoV, human coronavirus