Skip to main content

Table 2 Initial diagnosis PCR protocols and primers used

From: The first reported cases of elephant endotheliotropic herpesvirus infectious haemorrhagic disease in Malaysia: case report

Target gene Primer sequences (5′-3′) Product length (bp) References
Terminase Round 1:
TS-TERM_707s: TTGTGGACGAGRSIMAYTTYAT
TS-TERM_707as: ACAGCCACGCCNGTICCIGAIGC
Round 2:
TS-TERM_708s: GCAAGATCATNTTYRTITCITC
TS-TERM_708as: TGTTGGTCGTRWAIGCIGGRT
Round 1: 519
Round 2: 419
[29]
Polymerase Round 1:
DFA: GAYTTYGCNAGYYTNTAYCC
KG1: GTCTTGCTCACCAGNTCNACNCCYTT
ILK: TCCTGGACAAGCAGCARNYSGCNMTNAA
KG1: GTCTTGCTCACCAGNTCNACNCCYTT
Round 2:
TGV: TGTAACTCGGTGTAYGGNTTYACNGGNGT
IYG: CACAGAGTCCGTRTCNCCRTADAT
Round 1:
DFA/KGI: ~ 750
ILK/KGI: ~ 480
Round 2: 215–315
[30]
EEHV DNA Polymerase-
Specific EEHV 3/4
6719: CGTTGAAGGTGTCGCAGAT
7400: CAGCATCATCCAGGCCTACAAC
6720: ATCCTGGCGCAGCTGCTGAC
6721: CTCACCTGCAACGCCGTCTA
Round 1:
6719/7400: 390
Round 2:
6719/6720: 270
Round 3:
6719/6721: 150
[13]
EEHV DNA Polymerase-
PAN EEHV and specific EEHV 6
6710: ACAAACACGCTGTCRGTRTCYCCRTA
6711: GTATTTGATTTYGCNAGYYTGTAYCC
6712: TGYAAYGCCGTNTAYGGATTYACCGG
7584: CATCGATTTTGAACTTCTCATGGTC
Round 1:
6710/6711: 500
Round 2A: 6710/6712: 250
Round 2B: 6711/7584: 500
Round 3A:
6712/7584: 250
[13]
EEHV DNA Terminase B1 LGH2425: ACAGCCACGCCNGTNCCNGANGC
A2 LGH2428: TTGTGGACGAGRSNMAYTTYAT
A3 LGH2426: GCAAGATCATNTTYRTNTCNTC
B2 LGH2427: TGTTGGTCGTRWANGCNGGRTC
A3SEQ: CCCCATCTGAGCAAGATCAT
B2SEQ: GGCTGACAAATGTTGGTCGT
Round 1:
B1/A2: 575
Round 2:
A3/B2: 415 A3SEQ/B2SEQ: 360
[4]