Skip to main content

Table.1 Summary of primer sequences used in this study

From: GATA binding protein 4 promotes the expression and transcription of hepatitis B virus by facilitating hepatocyte nuclear factor 4 alpha in vitro

Gene Forward sequence (5′–3′) Reverse sequence (5′–3′)
β-actin GTCTTCCCCTCCATCGTG AGGGTGAGGATGCCTCTCTT
GATA4 CCTCTACCACAAGATGAACG CCTCTTTCCGCATTGCAAGA
HNF4α CTAACACGATGCCCTCTCAC GCAGGAGCTTGTAGGATTCAG
HBV 3.5 kb pgRNA GCCTTAGAGTCTCCTGAGCA GAGGGAGTTCTTCTTCTAGG
HBV total RNA ACCGACCTTGAGGCATACTT GCCTACAGCCTCCTAGTACA
HBV DNA TTCTCCGCCTGTCGTACC GGTTTCTGTGGGCGTTC
HDAC2 TGGACTCTTTGAGTTTTGTCAG CATCACCATGATGAATATCTAT