Skip to main content

Table 1 Primers sequences for human and viral PCR amplification

From: Human DNA decays faster with time than viral dsDNA: an analysis on HPV16 using pathology archive samples spanning 85 years

Primers Sequence 5′– 3’ Amplicon Size
TUBB-F TCCTCCACTGGTACACAGGC
TUBB-R1 CATGTTGCTCTCAGCCTCGG 65 bp
TUBB-R2 CTCCTCTTCGGCCTCCTCAC 149 bp
HPV16_L1-F AATAGGGCTGGTRCTGTTGG
HPV16_L1-R1 TGCAGTAGACCCRGAGCCTT 69 bp
HPV16_L1-R2 ATTTGGGCATCAGAGGTAACCAT 134 bp
\