Skip to main content

Table 2 Primers used for PCR amplification and sequencing. Column 1: Gene name. Column 2: primers sequence. Column 3: PCR product length

From: Targeting the Kaposi’s sarcoma-associated herpesvirus genome with the CRISPR-Cas9 platform in latently infected cells

Gene Primer pair *Size of PCR product
gfp 1st F: TCTTCTTCAAGGACGACGGC
2nd F: GCAGCTCGCCGACCACTAC
1st + 2nd R: TTACTTGTACAGCTCGTCCA
462 bp
226 bp
orf73 1st F: AGATGTGACCTTGGCGATG
2nd F: CAACCGCGAAGGAAGCAT
1st + 2nd R: CGGAGACACAGGATGGGATG
313 bp
282 bp
  1. *Sizes ignore potential deletions and insertions due to single or double cut by Cas9