Skip to main content

Table 1 Currently known HCMV miRNAs and/or potential miRNAs targets and their functions

From: MicroRNAs expressed by human cytomegalovirus

Pre-miRNA names Mature miRNA names Sequences Targets Main Function
mir-UL112 miR-UL112-3p aagugacggugagauccaggcu UL114 [14] escape immune elimination and induce viral latency
BCLAF1 [15]
MICB [16]
MICA [17]
UL112/113 [18]
UL120/121 [18]
IE72 [19]
IRF1 [20]
VAMP3 [21]
RAB5C [21]
RAB11A [21]
SNAP23 [21]
CDC42 [21]
ATG5 [22]
IKKα/β [23]
IL32 [24]
TLR2 [25]
miR-UL112-5p ccuccggaucacaugguuacuca ERAP1 [26] escape immune response
CASP3 [22]
mir-UL148D miR-UL148D ucguccuccccuucuucaccg RANTES [27] escape immune response and regulate apoptosis of host cells
IEX-1 [28]
ACVR1B [29]
ERN1 [30]
PHAP1 [30]
mir-UL22A miR-UL22A-3p ucaccagaaugcuaguuuguag CASP7 [22] participate in cell differentiation and immunity
SMAD3 [31]
miR-UL22A-5p uaacuagccuucccgugaga BMPR2 [32]
CASP3 [22]
SMAD3 [31]
mir-UL36 miR-UL36-3p uuuccagguguuuucaacgugc CDK6 [22] N/A
FAS [22]
miR-UL36-5p ucguugaagacaccuggaaaga UL138 [33] contribute to HCMV replication
SLC25A6 (ANT3) [34]
mir-UL59 miR-UL59 guucucucgcucgucaugccgu ULBP1 [35] escape immune elimination
mir-UL69 miR-UL69 ccagaggcuaagccgaaaccg N/A N/A
mir-UL70 miR-UL70-3p ggggaugggcuggcgcgcgg MOAP1 [29] inhibit mitochondria-induced apoptosis and the antiviral mechanism
ERN1 [29]
PHAP1 [29]
miR-UL70-5p ugcgucucggccucguccaga N/A N/A
mir-US4 miR-US4-3p ugacagcccgcuacaccucu ERAP 1[36] N/A
CASP7 [22]
CDK6 [22]
miR-US4-5p uggacgugcagggggaugucug PAK2 [37] inhibit antigen presentation
CASP2 [22]
ERAP1 [36]
QARS [36]
mir-US5-1 miR-US5-1 ugacaagccugacgagagcgu US7 [38] escape the immune system; increase the production of infectious particles during the late phase of infection;
VAMP3 [21]
RAB5C [21]
RAB11A [21]
SNAP23 [21]
CDC42 [21]
CDK6 [22]
FAS [22]
Gemini [39]
IKKα/β [23]
mir-US5-2 miR-US5-2-3p uaugauaggugugacgaugucu US7 [38]
VAMP3 [21]
RAB5C [21]
RAB11A [21]
SNAP23 [21]
CDC42 [21]
CDK6 [22]
FAS [22]
NAB1 [31]
miR-US5-2-5p cuuucgccacaccuauccugaaag N/A N/A
mir-US22 miR-US22-3p ucgccggccgcgcuguaaccagg US22 [40] N/A
miR-US22-5p uguuucagcguguguccgcggg US22 [40] regulate apoptosis of host cells
ATG5 [22]
EGR1 [41]
mir-US25-1 miR-US25-1-3p uccgaacgcuaggucgguucu CDK6 [22] reduce viral DNA synthesis
miR-US25-1-5p aaccgcucaguggcucggacc Cyclin E2 [42]
BRCC 3[42]
EID1 [42]
MAPRE2 [42]
CD147 [42]
TRIM28 [42]
mir-US25-2 miR-US25-2-3p auccacuuggagagcucccgcggu CASP3 [22]
CDK6 [22]
eIF4A1 [43]
miR-US25-2-5p agcggucuguucagguggauga N/A
mir-US29 miR-US29-3p cccacgguccgggcacaauca N/A N/A
miR-US29-5p uggaugugcucggaccgugacg ATG5 [22] regulate apoptosis of host cells
mir-US33 miR-US33-3p ucacgguccgagcacauccaa US29 [44] N/A
miR-US33-5p gauugugcccggaccgugggcg STX3 [45] decreases the number of HCMV DNA copies
CCND1 [22]
15 26 N/A=No targets or exact function were found currently)
  1. List of pre-miRNAs and mature miRNAs. Previously reported 16 pre-miRNAs and 26 mature miRNAs encoded by HCMV were listed in this table, along with their potential targets and main functions