Skip to main content

Table 2 Primers used in this study for the HRM assay and sequencing

From: First detection and molecular characterisation of pseudocowpox virus in a cattle herd in Zambia

Method Primers’ ID 5ʹ → 3ʹ sequence Amplicon size (bp) Target
HRM OPV-HRM-For AGGACTAGCCGCGGTAACTTT 56 Orthopoxviruses
OPV-HRM-Rev ACAAGATAGAAGCGATGGATACTT
CaPV-HRM-For TCCTGGCATTTTAAGTAATGGT 100 Capripoxviruses
CaPV-HRM-Rev GTCAGATATAAACCCGGCAAGTG
PPV-HRM-For TCGAAGATCTTGTCCAGGAAG 112 Parapoxviruses
PPV-HRM-Rev CCGAGAAGATCAACGAGGTC
Sequencing ORFV-B2Lf-For GACCTTCCGCGCTTTAATTT 1210 Parapoxviruses
ORFV-B2Lf-Rev CCCGCCTGCTAAAAGACT
\