Skip to main content

Table 2 Universal primer of PCR amplification and sequencing of ANK genes of six capripoxvirus strains [10]

From: Comparative analysis of ankyrin (ANK) genes of five capripoxviruses isolate strains from Xinjiang province in China

ORF Primer sequence(5′-3′) Length of amplicon (~bp)
ORF010 F1:CGGAATTCGCAATCATCAATTACTATGG (PCR)
R1:CCGCTCGAGAACTTTTTATTGTTTGCC (PCR)
636
ORF138 F1:CGGAATTCGATGATTTTGTTATACGATTAC (PCR)
R1:CCGCTCGAGTTATGGCGTATACACAAC (PCR)
GTTATACGATTACATCACGCTC (Seq.)
ATTCGTCAGGATCCAAAGTGAATAA (Seq.)
TGGGATTTGTTGCGTATT (Seq.)
1896
ORF140 F1:CGGAATTCGTCACCAAAAATGTCACTGT (PCR)
R1:CCGCTCGAGTTATAAAAAGTACTTCTTTG (PCR)
TTGCTACTAAAAAACGGTGC (Seq.)
TATCTAAGGATTTACGTGTATATGA (Seq.)
1497
ORF141.2 F1:CGGAATTCGACCATGGAATACATTAGTG (PCR)
R1:CCGCTCGAGTCATTTTATTGCCAACAAC (PCR)
ACAGTTTTGGGCAACAAAAG (Seq.)
1344
ORF145 F1:CGGAATTCGTATACTTACAAAATGGAT (PCR)
R1:CCGCTCGAGTAAATTTTACTTTAACGG (PCR)
AATACTTACAACGAGATTCGCC (Seq.)
1400