Skip to main content

Table 2 Sequencing primers for HA and NA of A(H1N1)pdm09 virus

From: Characterization of neuraminidase inhibitor-resistant influenza virus isolates from immunocompromised patients in the Republic of Korea

Primers (F/R) Gene (subtype) Locus Sequence (5′–3′)
A-uni-HA-1F HA 1–28 TATTCGTCTCAGGGAGCAAAAGCAGGGG
HA-H1-345F HA (H1) 345–365 GGAACGTGTTACCCAGGAGAT
HA-H1-680F HA (H1) 680–701 TCAAGCCGGAAATAGCAATAAG
HA-H1-1137F HA (H1) 1137–1156 AGCCGACCTGAAGAGCACAC
HA-H1-714R HA (H1) 691–714 CCTCACTTTGGGTCTTATTGCTAT
HA-H1-1093R HA (H1) 1072–1093 CATCCATCTACCATCCCTGTCC
HA-H1-1330R HA (H1) 1309–1330 GCATTGTAAGTCCAAATGTCCA
A-uni-HA-1807R HA 1773–1807 ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT
A-uni-NA-1F NA 1–29 TATTGGTCTCAGGGAGCAAAAGCAGGAGT
H1-NA-324F NA (N1) 324–345 GGTTCCAAGGGGGATGTGTTTG
H1-NA-744F NA (N1) 744–766 TGGACAGGCCTCATACAAGATCT
H1-NA-645R NA (N1) 622–645 AGTGTCTGTTATTATTCCGTTGTA
H1-NA-1010F NA (N1) 985–1010 CAGTATCGTCTAATGGAGCAAATGGA
H1-NA-1057R NA (N1) 1036–1057 CTATCCAAACACCATTGCCGTA
A-uni-NA-1442R NA 1407–1442 ATATGGTCTCGTATTAGTAGAAACAAGGAGTTTTTT
\