Skip to main content

Table 1 Oligonucleotides used for the construction of plasmids

From: Comparative effects of Novirhabdovirus genes on modulating constitutive transcription and innate antiviral responses, in different teleost host cell types

Primer Sequence (5′ → 3′) Restriction Site Primer Source Sequence Source
IHNV-M N se AGGAATTCATGACAGCGACACTCAGAG EcoRI   HM461966 (AEH95651)
IHNV-M N as AGGGTACCGTGGAATGAGTCGGAGTC KpnI
IHNV-M P se AGGAATTCATGTCGATGGAGAAGGAG EcoRI   HM461966 (AEH95652)
IHNV-M P as AGGGTACCTTGACTTGCTTCATGCGC KpnI
IHNV-M M se ACGAATTCATGTCTATTTTCAAGAGAGC EcoRI Ke et al., 2017 [35] HM461966 (AEH95653)
IHNV-M M as CTTGGTACCTTTTTCCTTCCCCCGCTTTTCGG KpnI
IHNV-M G se AGAATTCGAGATGGACCATGATCACCAC EcoRI   HM461966 (AEH95654)
IHNV-M G as AGGTACCTTGGACCGGTTTGCCAGGTG KpnI
IHNV-M NV se ACGAATTCATGGACCACCGCGACATAAACAC EcoRI   HM461966 (AEH95655)
IHNV-M NV as ACGGTACCTCTGGGATAAGCAAGAAAGTCTTC KpnI
VHSV-IVb N se CAGAATTCATGGAAGGAGGAATC EcoRI Ke et al., 2017 [35] KY359357 (ASZ84902)
VHSV-IVb N as GTGGTACCATCAGAGTCCTCG KpnI
VHSV-IVb P se CAGAATTCATGACTGATATTGAGAT EcoRI Ke et al., 2017 [35] KY359357 (ASZ84903)
VHSV-IVb P as GTGGTACCCTCTAACTTGTCCA KpnI
VHSV-IVb M se ACGAATTCATGGCTCTATTCAAAAGAAAGCGCACCATCCTG EcoRI Ke et al., 2017 [35] KY359357 (ASZ84904)
VHSV-IVb M as ACGGTACCCCGGGGTCGGACAGAG KpnI
VHSV-IVb G se ACGAATTGATGGAATGGAATACTT EcoRI Ke et al., 2017 [35] KY359357 (ASZ84905)
VHSV-IVb G as GTGGTACCGACCATCTGGCT KpnI
VHSV-IVb NV se ACGAATTCATGACGACCCAGTCGGCAC EcoRI Ke et al., 2017 [35] KY359357 (ASZ84906)
VHSV-IVb NV as ACGGTACCTGGGGGAGATTCGGAGCCA KpnI
  1. The restriction enzyme recognition sites are shown in bold. Sequence source is provided for both the full viral genome and for specific genes (in parenthesis)