Skip to main content

Table 1 List of primers used in the study for rapid detection of EV71 and CA16

From: Applicability of duplex real time and lateral flow strip reverse-transcription recombinase aided amplification assays for the detection of Enterovirus 71 and Coxsackievirus A16

Assay Primer/probe Sequence 5′- 3′ Genomic Position a Product size
Real time RAA EV71-exo-F CCTGCGAGTGCTTACCAATGGTTTTATGACGG 3026–3057 199 bp
EV71-exo-R GTATCCACGCCCTGACGTGCTTCATTCTCAT 3194–3224  
EV71-exo-P AACATGATGGGCACGTTCTCAGTGCGGAC-[FAM-dT]-[THF] -[BHQ-dT]-GGGGACCTCCAAGTC-C3-spacer 3119–3165  
CA16-exo-F GCAAGTAGTCACAGATTAGGCACTGGTGTTGT 2557–2588 161 bp
CA16-exo-R GCACGGCTAAAGAAATTCCCAATGGCTGTC 2688–2717  
CA16-exo-P GTGACAAGAATCTCATTGAGACKAGATG-[FAM-dT]-[THF] [BHQ-dT]-GTTGAACCATCACTCCA-C3-spacer 2633–2680  
IAC-P GTAAGGTGCTAGACTAAAATTGTTGGGACTT- [HEXdT]-G [THF]-A-[BHQ-dT]-CTCTGAAGTAAAAGG-C3-spacer   
LFS RAA EV71-LF-F CCTGCGAGTGCTTACCAATGGTTTTATGACGG 3026–3057 199 bp
EV 71-LF-R Biotin-GTATCCACGCCCTGACGTGCTTCATTCTCAT 3194–3224  
EV71-LF-P FAM-AACATGATGGGCACGTTCTCAGTGCGGAC -[THF]-TGGGGACCTCCAAGTC-C3-spacer 3119–3165  
CA16-LF-F GCAAGTAGTCACAGATTAGGCACTGGTGTTGT 2557–2588 161 bp
CA16-LF-R Biotin-GCACGGCTAAAGAAATTCCCAATGGCTGTC 2688–2717  
CA16-LF-P FAM -GTGACAAGAATCTCATTGAGACKAGATG-[THF] -TGTTGAACCATCACTCCA-C3-spacer 2633–2680  
  1. aGenome position depending on Enterovirus A71 strain HP (GenBank accession no.KY074643.1) and Coxsackievirus A16 isolate ZJ10–48 (GenBank accession no. KC755235.1)