Skip to main content

Table 1 List of primers used in the study for rapid detection of EV71 and CA16

From: Applicability of duplex real time and lateral flow strip reverse-transcription recombinase aided amplification assays for the detection of Enterovirus 71 and Coxsackievirus A16

AssayPrimer/probeSequence 5′- 3′Genomic Position aProduct size
Real time RAAEV71-exo-FCCTGCGAGTGCTTACCAATGGTTTTATGACGG3026–3057199 bp
EV71-exo-RGTATCCACGCCCTGACGTGCTTCATTCTCAT3194–3224 
EV71-exo-PAACATGATGGGCACGTTCTCAGTGCGGAC-[FAM-dT]-[THF] -[BHQ-dT]-GGGGACCTCCAAGTC-C3-spacer3119–3165 
CA16-exo-FGCAAGTAGTCACAGATTAGGCACTGGTGTTGT2557–2588161 bp
CA16-exo-RGCACGGCTAAAGAAATTCCCAATGGCTGTC2688–2717 
CA16-exo-PGTGACAAGAATCTCATTGAGACKAGATG-[FAM-dT]-[THF] [BHQ-dT]-GTTGAACCATCACTCCA-C3-spacer2633–2680 
IAC-PGTAAGGTGCTAGACTAAAATTGTTGGGACTT- [HEXdT]-G [THF]-A-[BHQ-dT]-CTCTGAAGTAAAAGG-C3-spacer  
LFS RAAEV71-LF-FCCTGCGAGTGCTTACCAATGGTTTTATGACGG3026–3057199 bp
EV 71-LF-RBiotin-GTATCCACGCCCTGACGTGCTTCATTCTCAT3194–3224 
EV71-LF-PFAM-AACATGATGGGCACGTTCTCAGTGCGGAC -[THF]-TGGGGACCTCCAAGTC-C3-spacer3119–3165 
CA16-LF-FGCAAGTAGTCACAGATTAGGCACTGGTGTTGT2557–2588161 bp
CA16-LF-RBiotin-GCACGGCTAAAGAAATTCCCAATGGCTGTC2688–2717 
CA16-LF-PFAM -GTGACAAGAATCTCATTGAGACKAGATG-[THF] -TGTTGAACCATCACTCCA-C3-spacer2633–2680 
  1. aGenome position depending on Enterovirus A71 strain HP (GenBank accession no.KY074643.1) and Coxsackievirus A16 isolate ZJ10–48 (GenBank accession no. KC755235.1)