Skip to main content

Advertisement

Table 1 Primers used in this study

From: Important roles of C-terminal residues in degradation of capsid protein of classical swine fever virus

Primer Sequence (5′–3′) Use
C-F GTACTCGAGATGTCTGATGATGGCGCA Amplification of C, CΔC, CΔ8, CΔ7, CΔ5 and CΔ2
CΔN-F TACTCGAGATGCCACCCGACGCT Amplification of CΔN
C-R ATGGATCCCGGGCTTCAACTGGTT Amplification of C and CΔN
CΔC-R ATGGATCCCGCTTAGTTCTGCTGTC Amplification of CΔC
CΔ8-R CGGATCCCGAATTGTTATTACCGC Amplification of CΔ8
CΔ7-R CGGATCCCGCATAATTGTTATTAC Amplification of CΔ7
CΔ5-R CGGATCCCGATACAACATAATTGT Amplification of CΔ5
CΔ2-R CGGATCCCGAACTGGTTGATACAA Amplification of CΔ2
qPCR-EGFP-F ATGGCCGACAAGCAGAAGAA qRT-PCR for detection of EGFP
qPCR-EGFP-R AACTCCAGCAGGACCATGTG
qPCR-C-F ACAGCAGAACTAAGCCACCC qRT-PCR for detection of C
qPCR-C-R TCTTGTTGTGGTACAGGCCG
qPCR-GAPDH-F GAAGGTCGGAGTGAACGGATTT qRT-PCR for detection of GAPDH
qPCR-GAPDH-R TGGGTGGAATCATACTGGAACA