Skip to main content

Table 3 The DNA fragments used for construction of GPV RC16 infectious clone with mutated NLS site in this study

From: The 164 K, 165 K, and 167 K residues of VP1 are vital for goose parvovirus proliferation in GEFs based on PCR-based reverse genetics system

DNA fragmentsThe sequence (5′-3′)
K164AGCAAAAAAAAATACAGGGAAGCTTACCGACCACTACCCGGTAGTTGCAAAGCCTAAACTTACCGAGGAAGTCAGTGCGGGAGGTGGTAGTAGTGCCGTACAAGACGGAGGAGCCACCGCGGAGGGTACCGAACCTGTGGCAGCAT
K165AGCAAAAAAAAATACAGGGAAGCTTACCGACCACTACCCGGTAGTTAAGGCACCTAAACTTACCGAGGAAGTCAGTGCGGGAGGTGGTAGTAGTGCCGTACAAGACGGAGGAGCCACCGCGGAGGGTACCGAACCTGTGGCAGCATC
K167AGCAAAAAAAAATACAGGGAAGCTTACCGACCACTACCCGGTAGTTAAGAAGCCTGCACTTACCGAGGAAGTCAGTGCGGGAGGTGGTAGTAGTGCCGTACAAGACGGAGGAGCCACCGCGGAGGGTACCGAACCTGTGGCAGCATC
AAPAGCAAAAAAAAATACAGGGAAGCTTACCGACCACTACCCGGTAGTTGCAGCACCTGCACTTACCGAGGAAGTCAGTGCGGGAGGTGGTAGTAGTGCCGTACAAGACGGAGGAGCCACCGCGGAGGGTACCGAACCTGTGGCAGCATC
KKRKGCAAAAAAAAATACAGGGAAGCTTACCGACCACTACCCGGTAGTTAAGAAGAGGAAACTTACCGAGGAAGTCAGTGCGGGAGGTGGTAGTAGTGCCGTACAAGACGGAGGAGCCACCGCGGAGGGTACCGAACCTGTGGCAGCATC
  1. The mutated sites were indicated by underline