Skip to main content

Table 2 The analyzed SNPs genetic data used in the study

From: Association of polymorphisms in inflammatory cytokines encoding genes with severe cases of influenza A/H1N1 and B in an Iranian population

Gene (SNP) Target Location Alleles Context sequence
rs16944 IL-1β Chr2: 113594867 G/A TACCTTGGGTGCTGTTCTCTGCCTC[G/A]
rs1800872 IL-10 Chr1: 206946407 T/G CTTTCCAGAGACTGGCTTCCTACAG[T/G]
rs2275913 IL-17 Chr 6: 52051033 A/G TGCCCTTCCCATTTTCCTTCAGAAG[A/G]
rs8099917 IL-28 Chr 19: 39743165 G/T TTTTGTTTTCCTTTCTGTGAGCAAT[G/T]