Skip to main content

Advertisement

Table 2 Primers used in this study

From: Biochemical characterization of recombinant Avihepatovirus 3C protease and its localization

Primer Sequence (5′-3′)
pET32a-3C-F CATATGATGCACCATCATCATCATCATAGCGGGCGGGTGAATTTCAGACATA
pET32a-3C-R AAGCTTTTATTGATTAAAAACTGGAAAGACCCTA
3C-H48A-R GTAAATTTAGACGCCCCAAATGTCA
3C-H48A-F TTTGGGGCGTCTAAATTTACACAAT
3C-C144A-R CAAGCACACCACCCGCGGAGCCAGG
3C-C144A-F GGCTCCGCGGGTGGTGTGCTTGTAG
EGFP-3C-F GAATTCTTATGAGCGGGCGGGTGAATTTCAGACATA
EGFP-3C-R GGATCCGGTTGATTAAAAACTGGAAAGACCCTA