Skip to main content

Advertisement

Table 3 Primers and probe combinations for the detection of rotavirus A (pan-rotavirus A, targeting the NSP3 gene) and specific amplification of the VP7 gene of equine rotavirus A G3 and G14 genotypes

From: Development and evaluation of a one-step multiplex real-time TaqMan® RT-qPCR assay for the detection and genotyping of equine G3 and G14 rotaviruses in fecal samples

Name Target Nucleotide Position Sequence (5′ to 3′)
NVP3-FDeg1 NSP3 963-982a ACCATCTWCACRTRACCCTC
NVP3-R11 NSP3 1053-1,034a GGTCACATAACGCCCCTATA
NVP3-Probe1 NSP3 984-1,026a Cy5-ATGAGCACAATAGTTAAAAGCTAACACTGTCAA-BHQ2
RVA-G3-756F VP7 (G3)b 756–777 GATGTTACCACGACCACTTGTA
RVA-G3-872R VP7 (G3)b 872–854 AGTTGGATCGGCCGTTATG
RVA-G3-779P VP7 (G3)b 779–823 FAM-TGGGACCACGAGAGAATGTAGCTGT-TAMRA
RVA-G14-ARG869F VP7 (G14)c 869–885 ATCCGACTACGGCTCCA
RVA-G14-ARG1011R VP7 (G14)c 1011–990 TGCAGCAGAATTTAATGATCGC
RVA-G14-ARG886P VP7 (G14)c 886–915 HEX-CAGATTGGACGAATGATGCGTATAAATTGG-MGB
  1. 1Primers and probe name and sequences derived from Freeman et al., 2008
  2. anucleotide position based on GenBank Accession number X81436
  3. bnucleotide position based on GenBank Accession number KM454497.1
  4. cnucleotide position based on GenBank Accession number KM454508.1
  5. Cy5, cyanine 5; BHQ2, black hole quencher 2; FAM, 6-carboxyfluorescein; TAMRA, tetramethylrhodamine; HEX, hexachloro-fluorescein; MGB, minor groove binder