Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers used for HCV quantification, genotyping and DE/17–0414 genome amplification

From: Characterization of a hepatitis C virus genotype 1 divergent isolate from an HIV-1 coinfected individual in Germany assigned to a new subtype 1o

Primera Sequence (5′-3′) Locationb Reference
Real-time RT-PCR assay for HCV quantification
 HCV-238_f GAGGAACTACTGTCTTCACG 49–68 This study
Heminested RT-PCR assay for HCV genotyping
 HCV-271_f ACCACATCMRSTCCGTGTGG 7951–7970 This study
Heminested RT-PCR assays for DE/17–0414 genome amplification
 HCV-235_r AGTACCACAAGGCCTTTCG 290–272 This study
 HCV-365_f GGCGTTAGTATGAGTGTTGTGC 87–108 (Lu et al., 2014)
 HCV-387_r TCTGGACTTCTCCCTCCACC 3531–3512 This study
  1. aForward primer designation end with _f; reverse primer designations end with _r
  2. bNumbering is according to the HCV prototype strain of H77 (GenBank Acc. No. AF009606)