Skip to main content

Advertisement

Table 1 Primers used for HCV quantification, genotyping and DE/17–0414 genome amplification

From: Characterization of a hepatitis C virus genotype 1 divergent isolate from an HIV-1 coinfected individual in Germany assigned to a new subtype 1o

Primera Sequence (5′-3′) Locationb Reference
Real-time RT-PCR assay for HCV quantification
 HCV-238_f GAGGAACTACTGTCTTCACG 49–68 This study
 HCV-239_r TCGCAAGCACCCTATCAG 310–293
 HCV-240_f TCGCAAGCACCCTATCAG 76–94
 HCV-235_r AGTACCACAAGGCCTTTCG 290–272
Heminested RT-PCR assay for HCV genotyping
 HCV-271_f ACCACATCMRSTCCGTGTGG 7951–7970 This study
 HCV-272_f TCCGTGTGGRARGACYTSCTRGA 7962–7984
 HCV-305_f CTCCGTMTGGGAGGACTTGC 7961–7980
 HCV-275_r CTSGTCATAGCYTCCGTGAA 8635–8616
Heminested RT-PCR assays for DE/17–0414 genome amplification
 HCV-235_r AGTACCACAAGGCCTTTCG 290–272 This study
 HCV-239_r TCGCAAGCACCCTATCAG 310–293
 HCV-365_f GGCGTTAGTATGAGTGTTGTGC 87–108 (Lu et al., 2014)
 HCV-366_r TCCCTGAAGAGTTGCGTATTCC 939–918
 HCV-367_r AGAAAGAGCAACCGGGAAGATT 864–843
 HCV-368_f TCTATCTTCCTTCTTGCCATCCTG 864–887
 HCV-369_f AGGGATTTACCATGTCACCAATGA 935–958
 HCV-370_r TCAAAGTCAGTAAGAGGTCGACAG 1747–1724
 HCV-371_f CCCGGTGCATGGTAGACTAC 2164–2183
 HCV-372_r CTCCACCCTCCGTTGGTTAG 3421–3492
 HCV-373_r CCGTTGGTTAGGGAGTCAGC 3412–3393
 HCV-374_f ACATTCTTGGCTACGTGCTGTA 3552–3573
 HCV-375_f CCCCATTATCCAGATGTACACCAA 3635–3658
 HCV-387_r TCTGGACTTCTCCCTCCACC 3531–3512 This study
 HCV-388_f GCCGCATCCAAACATTGAGG 4421–4440
 HCV-389_f CGGCAAAGCTATCCCCCTAG 4478–4497
 HCV-390_r CCCGCCTGTTTTGTCTGAGA 5089–5070
 HCV-391_f GCATCCAAAGAGGCTGAGGT 5565–5584
 HCV-392_f CATCCCTGCTGTCCCAACTT 5588–5607
 HCV-393_r TTATGTCAGCTCCGCATGGG 6456–6437
 HCV-394_f GACGCCGACCTCATAGAAGC 7017–7036
 HCV-395_r TGGCGTAACAAGGAGTTGCT 7708–7689
HCV-396_r ATGGGCAGCTTGTTCTCCTC 7678–7659
 HCV-360_f CTCACCTGCTATCTCAAGGCAA 8487–8508
 HCV-361_f GTTATCTGTGAGAGTAGCGGGG 8574–8595
  1. aForward primer designation end with _f; reverse primer designations end with _r
  2. bNumbering is according to the HCV prototype strain of H77 (GenBank Acc. No. AF009606)