Skip to main content

Advertisement

Table 1 Arbovirus-specific primers used for amplification in this study

From: Genetic diversity of the Yokose virus, XYBX1332, isolated from bats (Myotis daubentonii) in China

  Sequence of primers(5′-3′) Amplify region Length of product References
Flavivirus
 FU1 TACCACATGATGGGAAAGAGAGAGAA NS5 310 13
 CFD2 GTGTCCCAGCCGGCGGTGTCATCAGC
Alphavirus
 M2W YAGAGCDTTTTCGCAYSTRGCHW NS1 434/310 13
 cM3 W ACATRAANKGNGTNGTRTCRAANCCDAYCC
 M2 W2 TGYCCNVTGMDNWSYVCNGARGAYCC
Bunyavirus
 BUP ATGACTGAGTTGGAGTTTGATGTCGC S 251 13, 14
 BDW TGTTCCTGTTGCCAGGAAAAT