Skip to main content

Advertisement

Table 4 Primers and probes used in this work

From: A multiplex one-tube nested real time RT-PCR assay for simultaneous detection of respiratory syncytial virus, human rhinovirus and human metapneumovirus

Virus Oligo Sequence (5’to 3’) Primer lengths(bp) Product size(bp) Gene References
RSV Fa CA + CW + GAA + GA + TG + CWAAT+CATAAATTCA 26 374 N [8, 26]
Ra CW + GA + TC + TRT + CT + CCT + GCTGCTA 21  
F CACWGAAGATGCWAATCATAAATTCA 26 89
R GTATYTTTATRGTGTCTTCYCTTCCTAACC 30  
Probe FAM-TAATAGGTATGTTATATGCKATGTC-BHQ1 25  
HRV Fa HC + AA+GYA + CTTCT+GTYWCCCCSG 22 397 5′UTR [9, 27]
Ra GA + AA+CAC + GGA + CA + CCCAAAGTAGT 23  
F TGGACAGGGTGTGAAGAGC 19 144
R CAAAGTAGTCGGTCCCATCC 20  
Probe Cy5-TCCTCCGGCCCCTGAATG-BHQ3 18  
HMPV Fa CATATAAG+CA + T + G + C + TA + TATTAAAA+GAGTCTC 30 475 N [10, 14]
Ra GT + GAATATTAA+G + G + CA + C + CTACACATAATAARA 31  
F CATATAAGCATGCTATATTAAAAGAGTCTC 30 163
R CCTATTTCTGCAGCATATTTGTAATCAG 28  
Probe VIC-TGYAATGATGAGGGTGTCACTGCGGTTG-BHQ1 28  
  1. aA ‘+’ symbol in front of nucleotides indicates the LNA modification; FAM, 6-carboxyfluorescein; Cy5, Cyanine5; VIC, 2’-chloro-7’-phenyl-1,4-dichloro-6-carboxyfluorescein; BHQ, Black Hole Quencher