Skip to main content

Advertisement

Table 1 Primers used for RT-qPCR

From: NS3 Protein from Rice stripe virus affects the expression of endogenous genes in Nicotiana benthamiana

Code of gene F(5′-3′) R(5′-3′)
ATP-2-NbS00015227g0002 TATTCAAGCAGTTTATGTACCCGC TGGGCTGTTTCGTAATGTTTCTC
HIS -0-NbS00000634g0101 AACAGCACGTAAATCCACTGGAG AACCCACCAAGTAAGCCTCTG
HIS- 2-NbS00002567g0001 ATGGCGAGAACCAAACAAACAG TCCTGCGCTATTTCTCTTACC
LRR-1-NbS00005377g0007 AGTGGGAGTATACCTGACAG ATTGATACAGAGGCCAAGTTCAG
LRR-2-NbS00007194g0113 TAGTTACAACTGCGGTCGATG TCCAGATCCAAACATTCCACG
preoxidase-2-NbS00013071g0001 AGGCTATTCAATTTCAACTCCAC CTTGTAGAAGCATCGGTCCAC
Psb-3-NbS00027134g0004 ATCCAGAGCAAGACATACATG ATCAAGAGTGTAGGTTAAGCG
NBC-3-NbS00003711g0003 TCTACCAGAAATTGAGGACCG ATTCAATTGCGTGGGGTGAGC
HSFP-NbS00043262g0009 GGAGGAGGAATGTTGGTCAAAGC CACATTTATCCAAGTATTGCTGG
Rh-1-NbS00007177g0002 AGGAGCTCAACTAAGTGATGTG ACCTAAGTCATTATCTGTGTTC
Ser-p-3-NbS00032762g0006 AGGCGATGGTACTATTGTTTC ACATCAGCAGAGAAATAATGTGC
Psbp- 3-NbS00027024g0003 TGAAGCCATTGTCCTCCATC TAGGAGAAGTAGGAAGGTAAG
  1. F, Forward Primer; R, Reverse Primer