Skip to main content

Advertisement

Table 1 Primers used for RT-PCR

From: Impact of TGEV infection on the pig small intestine

Gene or bacterial target Primer sequence (5′-3′) Product size
GAPDH F: TCATCATCTCTGCCCCTTCT 172 bp
R: GTCATGAGTCCCTCCACGAT
IL-1β F:AGAGGGACATGGAGAAGCGA 209 bp
R: GCCCTCTGGGTATGGCTTT
IL-6 F:CCTCGGCAAAATCTCTGCAA 189 bp
R: TGAAACTCCACAAGACCGGT
IL-8 F: CCTCATTCCTGTGCTGGTCA 273 bp
R:TGCAAGTTGAGGCAAGAAGAC
TGF-β F: CGCGTGCTAATGGTGGAAAG 132 bp
R: TGCCCGAGAGAGCAATACAG
TNF-α F:GCCCTTCCACCAACGTTTTC 158 bp
R: TCCCAGGTAGATGGGTTCGT
IL-10 F: TCTGAGAACAGCTGCATCCAC 112 bp
R: CGCCCATCTGGTCCTTCGTT
Total bacteria F: GTGSTGCAYGGYYGTCGTCA 147 bp
R: ACGTCRTCCMCNCCTTCCTC
Lactobacillus F: AGAGGTAGTAACTGGCCTTTA 391 bp
R: GCGGAAACCTCCCAACA
Entero-bacteriaceae F: ATGGCTGTCGTCAGCTCGT 385 bp
R: CCTACTTCTTTTGCAACCCACTC