Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 primers sequence of miRNAs

From: Pretreatment microRNA levels can predict HBsAg clearance in CHB patients treated with pegylated interferon α-2a

Gene   Sequence
hU6 F primer CAGCACATATACTAAAATTGGAACG
R primer ACGAATTTGCGTGTCATCC
hsa-miR-3960 F primer ATATTGCGGCGAGTCCGA
R primer TATGGTTGTTCACGAGTCCTTGTC
hsa-miR-23a-3p F primer GAAGTCTATCACATTGCCAGGG
R primer TATGGTTGTTCTCGTCTCTGTGTC
hsa-miR-335-5p F primer CGTCCTCGTCAAGAGCAATAAC
R primer TATGCTTGTTCTCGTCTCTGTGTC
hsa-miR-126-3p F primer ACAGTTCTCTCGTACCGTGAGTAAT
R primer TATGGTTTTGACGACTGTGTGAT