Skip to main content

Advertisement

Table 1 Primers used for RT-PCR

From: Pulmonary edema following central nervous system lesions induced by a non- mouse-adapted EV71 strain in neonatal BALB/c mice

Target gene Forward primer (5′ to 3′) Reverse primer (5′ to 3′) Source
EV TCCGGCCCCTGAATGCGGCTAATCC ACACGGACACCCAAAGTAGTCGGTCC PrimerBank
EV71 GCAGCCCAAAAGAACTTCAC ATTTCAGCAGCTTGGAGTGC PrimerBank
CA16 ATTGGTGCTCCCACTACAGC TCAGTGTTGGCAGCTGTAGG PrimerBank