Skip to main content

Advertisement

Table 1 PCR primers of RdRp, S genes of four HCoVs

From: Prevalence and genetic diversity analysis of human coronaviruses among cross-border children

Target genes HCoVs Primer Sequence (5′- 3′) Location
RdRp OC43 F CGAGTGTAGATGCCCGTCTCG 13,353-13,373
   R GCATCTGTCTTAACAACATCATC 15,990-15,970
  HKU1 F GAATGCCCGGCTAGTACCCTGTGC 13,581-13,604
   R GGGTAAGCATCTATAGCTAGAC 16,127-16,106
  NL63 F GGCACGGACATCGATAAGTGTG 112,481-12,505
   R GCATCTGTCTTAACAACATCATC 14,954-14,932
  229E F CTGAAGTCCAATTGTGTGCGC 12,493-12,513
   R CACCTTCGTTAAGAGTCTTGTTGAG 15,034-15,010
S OC43 F TCCCTGATTTACCCATTTGTG 23,486-23,506
   R ATAGTTAATGGGTTGCAGCTGT 25,807-25,786
  HKU1 F-1 TATGTTAATAAWACTTTGTATAGTG 23,236-23,260
   R-1 TACAATTGACAAGAACTAGAAG 24,179-24,158
   F-2 ACCTCTTAATTGGGAACGTA 23,922-23,941
   R-2 GAAGATCTCTAATTTCACTACCAC 25,717-25,694
  NL63 F GAGTGGTAGGTTGTTGTTACGCAATAATGG 20,403-20,432
   R GTCACGCAAGACAGTAACATCATGAGGTGG 24,643-24,614