Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Sequence and characteristics of primer pairs

From: Molecular characterization of the duck enteritis virus US10 protein

Primer Primer sequence (5′-3′) Gene Product size (bp)
P1 GAATTCATGAAGAGGCGCTGTCTCAAT DEV US10 988
P2 AAGCTTTAGAGTATCAGTCAGAGTCATCGTAG
P3 CATCCAGTTGCTCCCGT DEV US10 (for qRT-PCR) 131
P4 GCGTGACCTAGACAACACC
P5 CGGGCATCGCTGACA Duck β-actin gene 177
P6 GGATTCATCATACTCCTGCTTGCT
P7 AAGATGCTATGCTGCTAATA DEV UL55 740
P8 CTGTTCGATCTTTACTATTA