Skip to main content

Advertisement

Table 1 Primers used for amplifying Nsp10 gene fragments and the corresponding amino acid sequence and size of each fragment

From: Epitope mapping and characterization of a novel Nsp10-specific monoclonal antibody that differentiates genotype 2 PRRSV from genotype 1 PRRSV

Name Primer sequence (5′-3′) Amino acid (aa) sequence Size (aa)
A-1 F GAATTCTGGGAAGAAGTCCAGAATG 1GKKSR……QTRRG100 100
R GGTACCTCATCCGCGGCGAGTCTGG
A-2 F GAATTCTTTAGTCTCCGTTAGGCG 101LVSVR……TLQFP200 100
R GGTACCTCAAGGGAATTGCAGCGTTG
A-3 F GAATTCTGCCCCCTCCCGTACCGG 201APSRT……MSMVN300 100
R GGTACCTCAGTTGACCATGGACATAAG
A-4 F GAATTCTACGACCCGTGTGACCTAC 301TTRVT……CADLE441 141
R GGTACCTCATTCCAGGTCTGCGCAAATAG
B-1 F GAATTCTGCCCCCTCCCGTACCGG 201APSRT……LRLLS240 40
R GGTACCTCAACTGAGAAGCCTCAAG
B-2 F GAATTCTAATCACCTTGATGTCTTG 231NHLDV……DIMPQ270 40
R GGTACCTCACTGAGGCATGATGTCA
B-3 F GAATTCTCATTGCTATGTATTTGAC 261HCYVF……MSMVN300 40
R GGTACCTCAGTTGACCATGGACATAAG
C-1 F GAATTCTCATTGCTATGTATTTGAC 261HCYVF……IWRFG280 20
R GGTACCTCACCCGAACCTCCAGATGG
C-2 F GAATTCTACCCAATTAAAGACCATC 271TQLKT……AIQPD290 20
R GGTACCTCAATCTGGTTGAATGGCATC
C-3 F GAATTCTCAGAATATCTGTGATGC 281QNICD……MSMVN300 20
R GGTACCTCAGTTGACCATGGACATAAG
D-1 F GAATTCTCAGAATA…CAAACTTTGAGGTACC 281QNICDAIQPDYRDKL295 15
R GGTACCTCAAAGTTTG…TATTCTGAGAATTC
D-2 F GAATTCTGCCATTC…GGTCAACTGAGGTACC 286AIQPDYRDKLMSMVN300 15
R GGTACCTCAGTTGACC…GAATGGCAGAATTC
E-1 F GAATTCTGCC…GAT…GAC…CTTTGAGGTACC 286AIQPDYRDKL295 10
R GGTACCTCAAAG…GTC…ATC…GGCAGAATTC
E-1- mutant F GAATTCTGCC…TGT…GAG…CTTTGAGGTACC 286AIQPCYREKL295 10
R GGTACCTCAAAG…CTC…ACA…GGCAGAATTC
E-2 F GAATTCTGCCATTCAA…GACAAATGAGGTACC 286AIQPDYRDK294 9
R GGTACCTCATTTGTC...TTGAATGGCAGAATTC
E-3 F GAATTCTATTCAA…GACAAACTTTGAGGTACC 287IQPDYRDKL295 9
R GGTACCTCAAAGTTTGTC...TTGAATAGAATTC
  1. The forward (F) and reverse (R) primers contain EcoRI and kpnI recognition sites, respectively (underlined). The superscript numbers indicate the relative location of the amino acids in Nsp10 protein