Skip to main content

Advertisement

Table 1 Primers used in this paper

From: Preliminary study of the UL55 gene based on infectious Chinese virulent duck enteritis virus bacterial artificial chromosome clone

NO. Primers Sequence (5’-3’) Product
1 TKA-HOMO-for gaattcatgcttgccatcataaccgtattctc TK left homology arm
TKA-HOMO-rev tctagaataacttcgtataatgtatgctatacgaagttatcacctcgagcttttctttcctgtg
2 TKB-HOMO-for gcatgcacatagcaacaactgacgcaaaagc TK right homology arm
TKB-HOMO-rev aagctttcccagaaagctcgcctaggtcctc
3 EGFP-for tctagatagttattaatagtaatcaattacg EGFP
EGFP-rev gtcgacatgcagtgaaaaaaatgct
4 sopB-for attcgttaattgcgcgcgtagg sopB
sopB-rev gaatattcaggccagttatgct
5 repA-for catggcggaaacagcggttatc repA
repA-rev atgtatgagaggcgcattggag
6 TK-for cgcggatcccactgaatgtcactgc TK
TK-rev cccaagctttcaattaattgtcatctcggt
7 ΔUL55-KanR-for gaaaggcggttggaataagaggaacgaggcggtagacgtgaccgacaacagtgtaggctggagctgcttc KanR gene flanked by homology arms of UL55
ΔUL55-KanR-rev tttcttatggttttaataaaacgctttattacattgtagtgtaacaagaccatatgaatatcctccttag
8 ΔUL55/ΔUL55R-for tgcaaattagtgggaggtacg ΔUL55/ΔUL55R identification product
ΔUL55/ΔUL55R-rev cccaaataccctgttagtagctt
9 ΔUL55R-UL55-for atggccgacgcgaaggcggt UL55 fragment with left homology arm of UL55
ΔUL55R-UL55-rev gaagcagctccagcctacactcatacattagctttgtg
10 ΔUL55R-KanR-for cacaaagctaatgtatgagtgtaggctggagctgcttc UL55 fragment with right homology arm of UL55
ΔUL55R-KanR-rev tttcttatggttttaataaaacgctttattacattgtagtgtaacaagaccatatgaatatcctccttag
  1. Italic: Complementary sequence for overlap PCR