Skip to main content

Table 3 Oligonucleotide primers for detection of AIV, NDV, IBV, and IBDV

From: New oligonucleotide microarray for rapid diagnosis of avian viral diseases

Name Primer sequence (5` → 3`) Position in genome PCR product size, bp
IBDV-VP2 (F) GAGCTGATCCCAAATCCTGAA
(R) GCGTCTTCCACTGTCGTAATAA
1244–1264
1836–1815
593
IBV-S1 (F) TATGGCAGAACTGGCCAAGG
(R) AAGGTGCCACAAACTGTTCC
21,622–21,641
22,042–22,023
421
NDV-NP (F) ATGACATTGCTAGGCGACAG
(R) GAATTGTGTCTCTCCGTCCC
1051–1070
1461–1442
411
AIV Flu-NP (F) GGAACCACCAACCAACAGA
(R) TCCTCTGCATTGTCTCCGAA
1180–1198
1484–1465
305
AIV Flu-M (F) TCTCATAGGCAAATGGTGGC
(R) AGACTCAGGTACTCCTTCCG
506–525
926–907
421