Skip to main content

Advertisement

Table 3 Oligonucleotide primers for detection of AIV, NDV, IBV, and IBDV

From: New oligonucleotide microarray for rapid diagnosis of avian viral diseases

Name Primer sequence (5` → 3`) Position in genome PCR product size, bp
IBDV-VP2 (F) GAGCTGATCCCAAATCCTGAA (R) GCGTCTTCCACTGTCGTAATAA 1244–1264 1836–1815 593
IBV-S1 (F) TATGGCAGAACTGGCCAAGG (R) AAGGTGCCACAAACTGTTCC 21,622–21,641 22,042–22,023 421
NDV-NP (F) ATGACATTGCTAGGCGACAG (R) GAATTGTGTCTCTCCGTCCC 1051–1070 1461–1442 411
AIV Flu-NP (F) GGAACCACCAACCAACAGA (R) TCCTCTGCATTGTCTCCGAA 1180–1198 1484–1465 305
AIV Flu-M (F) TCTCATAGGCAAATGGTGGC (R) AGACTCAGGTACTCCTTCCG 506–525 926–907 421