Skip to main content

Table 1 Primers for construction of enkaryotic expression vectors

From: Identification of host cellular proteins that interact with the M protein of a highly pathogenic porcine reproductive and respiratory syndrome virus vaccine strain

Primer Sequence (5′-3′) Use
HA-NF45-F CCGGAATTCGGATGAGGGGTGACAGAG Construction of pCMV-HA-NF45
HA-NF45-R CCGCTCGAG TCACTCCTGAGTTTCCATG
HA-PCNA-F CGCGTCGACCATGTTCGAGGCGCGCC Construction of pCMV-HA-PCNA
HA-PCNA-R CCGCTCGAGCTAAGACCCTTCTTCATCTTCG
HA-M-F CCGGAATTCGGATGGGGTCGTCTCTAGACG Construction of pCMV-HA-M
HA-M-R CCGCTCGAG TTATTTGGCATATTTAACAAGG
Flag-NF45-F CCGGAATTCGGATGAGGGGTGACAGAG Construction of pCAGGS-Flag-NF45
Flag-NF45-R CCGCTCGAGCACTCCTGAGTTTCCATG
Flag-PCNA-F GCCGAGCTCAATGTTCGAGGCGCG Construction of pCAGGS-Flag-PCNA
Flag-PCNA-R CCGCTCGAGTAAGACCCTTCTTCATCTTCG
  1. Note: F denotes forward PCR primer, R denotes reverse PCR primer; restriction sites are underlined; the termination codons are bold
\