Skip to main content

Table 1 Primers used in cloning and mutagenesis

From: Construction of a molecular clone of ovine enzootic nasal tumor virus

Primer Name Sequence 5’ to 3’
E5F AGCAAGGATCAGCCATTCT
E5R GAACACAGATAAAGGGAGGC
E3F TAACACCCAACTAGTAAAGCTG
E3R GGCTGATACCTTGCTTTATTG
CMVF GCTCTAGACGTTACATAACTTACGGTAAATGGCC
RCMVR AGAATGGCTGATACCTTGCCGGAGGCTGGATCGGTC
EGagR TCCCCTACCTTTTTCCATGTT
JEenvR ATTTCTCTATCCCATCCTAAGG
EU5F CCCATCTTTTGCCTCTCTTAT
EenvR CTCCGTTTTGTATCCGTTGC
JU5F CCCCATCTTTTGTCTCTCTCTT
JenvR CCCATTTTGTACCCGCTGT
EproS199P F GGCCTACTACATGGCCAAAACAGACGGCTATTTCC
EproS199P R AAATAGCCGTCTGTTTTGGCCATGTAGTAGGCCAAT
EproT202M F ACATGGCCAAAACAGATGGCTATTTCCACTCT
EproT202M R GAGTGGAAATAGCCATCTGTTTTGGCCATGTA
EproT289I F AAACAACATCAAGGCATCATTTTGCCCCTTGAT
EproT289I R ATCAAGGGGCAAAATGATGCCTTGATGTTGTTT
  1. Primers utilized in the generation and mutagenesis of the molecular clone and in screening for ENTV-1 transcripts derived from the molecular clone are listed along with the corresponding sequences on the right (5’ to 3’)